OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human CD5 activation kit by CRISPRa

Be the first to review this product
SKU
GA100648
CD5 CRISPRa kit - CRISPR gene activation of human CD5 molecule
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA802427 CD5 mouse monoclonal antibody, clone OTI10F4 (formerly 10F4) 100 ul
$447.00
RC206494 CD5 (Myc-DDK-tagged)-Human CD5 molecule (CD5)
10 ug
$457.00

Other products for "CD5"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol CD5
Locus ID 921
Components

GA100648G1, CD5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAACCGGGGAGTGTCTAAGT

GA100648G2, CD5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGTGTCTAAGTGGGTCTAA

GA100648G3, CD5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAATCGGGCATAAGACAAT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_014207, NM_001346456
UniProt ID P06127
Synonyms LEU1; T1
Summary This gene encodes a member of the scavenger receptor cysteine-rich (SRCR) superfamily. Members of this family are secreted or membrane-anchored proteins mainly found in cells associated with the immune system. This protein is a type-I transmembrane glycoprotein found on the surface of thymocytes, T lymphocytes and a subset of B lymphocytes. The encoded protein contains three SRCR domains and may act as a receptor to regulate T-cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Oct 2016
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN206494 CD5 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN206494BN CD5 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN206494LP CD5 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN206494RB CD5 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN406494 CD5 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products