OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human CACNA1C activation kit by CRISPRa

Be the first to review this product
SKU
GA100540
CACNA1C CRISPRa kit - CRISPR gene activation of human calcium voltage-gated channel subunit alpha1 C
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA309306 Mouse Monoclonal anti-CACNA1C Antibody
100 ug
$745.00
RC221025 CACNA1C (Myc-DDK-tagged)-Human calcium channel, voltage-dependent, L type, alpha 1C subunit (CACNA1C), transcript variant 18
10 ug
$2,646.00

Other products for "CACNA1C"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol CACNA1C
Locus ID 775
Components

GA100540G1, CACNA1C gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTTGATAGACCCTCTTGTG

GA100540G2, CACNA1C gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGATCACCATGCCTTAGGG

GA100540G3, CACNA1C gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGTAAAGCCACTGGCTGAG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_000719, NM_001129827, NM_001129829, NM_001129830, NM_001129831, NM_001129832, NM_001129833, NM_001129834, NM_001129835, NM_001129836, NM_001129837, NM_001129838, NM_001129839, NM_001129840, NM_001129841, NM_001129842, NM_001129843, NM_001129844, NM_001129846, NM_001167623, NM_001167624, NM_001167625, NM_199460
UniProt ID Q13936
Synonyms CACH2; CACN2; CACNL1A1; CaV1.2; CCHL1A1; LQT8; TS
Summary This gene encodes an alpha-1 subunit of a voltage-dependent calcium channel. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. The alpha-1 subunit consists of 24 transmembrane segments and forms the pore through which ions pass into the cell. The calcium channel consists of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. There are multiple isoforms of each of these proteins, either encoded by different genes or the result of alternative splicing of transcripts. The protein encoded by this gene binds to and is inhibited by dihydropyridine. Alternative splicing results in many transcript variants encoding different proteins. Some of the predicted proteins may not produce functional ion channel subunits. provided by RefSeq, Oct 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN421025 CACNA1C - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products