OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human Androgen Receptor (AR) activation kit by CRISPRa

Be the first to review this product
SKU
GA100263
AR CRISPRa kit - CRISPR gene activation of human androgen receptor
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA809105 AR mouse monoclonal antibody, clone OTI1D3 (formerly 1D3) 100 ul
$447.00
RC215316 AR (Myc-DDK-tagged)-Human androgen receptor (AR), OriGene unique variant 1
10 ug
$589.00 $840.00

Other products for "AR"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol AR
Locus ID 367
Components

GA100263G1, Androgen Receptor gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATGCAACAGTTTGCGAGTC

GA100263G2, Androgen Receptor gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGGGAGGGAAAAGGAGGT

GA100263G3, Androgen Receptor gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGTGGGAAGGCAAGGAGGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_000044, NM_001011645, NM_001348061, NM_001348063, NM_001348064
UniProt ID P10275
Synonyms AIS; AR8; DHTR; HUMARA; HYSP1; KD; NR3C4; SBMA; SMAX1; TFM
Summary The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Jan 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN415316 AR - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

Co-expression and clinical utility of AR-FL and AR splice variants AR-V3, AR-V7 and AR-V9 in prostate cancer
Wüstmann, Seitzer, Humberg et al
Biomark Res (2023) 11 (1), 37 DOI: 10.1186/s40364-023-00481-w
Cited by 14
AI Summary: OriGene’s CRISPR/dCas9 AR activation system (#GA100263) was used to induce endogenous AR gene expression in cell lines, enabling the study of how increased AR pre-mRNA levels affect the co-expression of AR full-length and splice variants in prostate cancer.
Snippet: M enzalutamide (Selleck Chemicals LLC, Houston, TX, USA) for up to 14 days. Induction of endogenous AR gene expression was performed using a modified CRISPR/dCas9 AR activation system ((#GA100263), Origene, Rockville, MD, USA). Cells in a 24 well plate were transfected with 500 ng gRNA or scramble control plasmids along with 150 ng enhancer plasmid using the ViaFect Transfection Reagent (Pr
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products