SNRPF (NM_003095) Human Untagged Clone

SKU SC320607

SNRPF (untagged)-Human small nuclear ribonucleoprotein polypeptide F (SNRPF)

Product Data

• Type: Human Untagged Clone
• Target Symbol: SNRPF
• Synonyms: Sm-F; SMF; snRNP-F
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_003095, the custom clone sequence may differ by one or more nucleotides; ; ; ATGAGTTTACCCCTCAATCCCAAACCTTTCCTCAATGGACTAACAGGAAAGCCAGTGATGGTGAAACTTA; AGTGGGGAATGGAGTACAAGGGCTATCTGGTATCTGTAGATGGCTACATGAACATGCAGCTTGCAAATAC; AGAAGAATACATAGATGGAGCTTTGTCTGGACATCTGGGTGAAGTTTTAATAAGGTGTAATAATGTCCTT; TATATCAGAGGTGTGGAAGAAGAGGAAGAAGATGGGGAAATGAGAGAATAG; ;
• Restriction Sites: Please inquire
• ACCN: NM_003095
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_003095.2, NP_003086.1
• RefSeq Size: 806 bp
• RefSeq ORF: 261 bp
• Locus ID: 6636
• UniProt ID: P62306
• Cytogenetics: 12q23.1
• Domains: Sm
• Protein Families: Stem cell - Pluripotency
• Protein Pathways: Spliceosome
• Summary: Plays role in pre-mRNA splicing as core component of the SMN-Sm complex that mediates spliceosomal snRNP assembly and as component of the spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome (PubMed:11991638, PubMed:18984161, PubMed:19325628, PubMed:23333303, PubMed:25555158, PubMed:26912367, PubMed:28502770, PubMed:28781166, PubMed:28076346). Component of both the pre-catalytic spliceosome B complex and activated spliceosome C complexes (PubMed:11991638, PubMed:28502770, PubMed:28781166, PubMed:28076346). Is also a component of the minor U12 spliceosome (PubMed:15146077). As part of the U7 snRNP it is involved in histone 3'-end processing (PubMed:12975319).[UniProtKB/Swiss-Prot Function]