OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

EIF3S2 (EIF3I) (NM_003757) Human Untagged Clone

Be the first to review this product
SKU
SC320585
EIF3I (untagged)-Human eukaryotic translation initiation factor 3, subunit I (EIF3I)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA358798 EIF3I Antibody - C-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "EIF3S2 or NM_003757"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol EIF3S2
Synonyms eIF3-beta; eIF3-p36; EIF3S2; PRO2242; TRIP-1; TRIP1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003757.2 GCGTCACAGCCGGGATGAAGCCGATCCTACTGCAGGGCCATGAGCGGTCCATTACGCAGA
TTAAGTATAACCGCGAAGGAGACCTCCTCTTTACTGTGGCCAAGGACCCTATCGTCAATG
TATGGTACTCTGTGAATGGTGAGAGGCTGGGCACCTACATGGGCCATACCGGAGCTGTGT
GGTGTGTGGACGCTGACTGGGACACCAAGCATGTCCTCACTGGCTCAGCTGACAACAGCT
GTCGTCTCTGGGACTGTGAAACAGGAAAGCAGCTGGCCCTTCTCAAGACCAATTCGGCTG
TCCGGACCTGCGGTTTTGACTTTGGGGGCAACATCATCATGTTCTCCACGGACAAGCAGA
TGGGCTACCAGTGCTTTGTGAGCTTTTTTGACCTGCGGGATCCGAGCCAGATTGACAACA
ATGAGCCCTACATGAAGATCCCTTGCAATGACTCTAAAATCACCAGTGCTGTTTGGGGAC
CCCTGGGGGAGTGCATCATCGCTGGCCATGAGAGTGGAGAGCTCAACCAGTATAGTGCCA
AGTCTGGAGAGGTGTTGGTGAATGTTAAGGAGCACTCCCGGCAGATCAACGACATCCAGT
TATCCAGGGACATGACCATGTTTGTGACCGCGTCCAAGGACAACACAGCCAAGCTTTTTG
ACTCCACAACTCTTGAACATCAGAAGACTTTCCGGACAGAACGTCCTGTCAACTCAGCTG
CCCTCTCCCCCAACTATGACCATGTGGTCCTGGGCGGTGGTCAGGAAGCCATGGATGTAA
CCACAACCTCCACCAGGATTGGCAAGTTTGAGGCCAGGTTCTTCCATTTGGCCTTTGAAG
AAGAGTTTGGAAGAGTCAAGGGTCACTTTGGACCTATCAACAGTGTTGCCTTCCATCCTG
ATGGCAAGAGCTACAGCAGCGGCGGCGAAGATGGTTACGTCCGTATCCATTACTTCGACC
CACAGTACTTCGAATTTGAGTTTGAGGCTTAAGAAGCTGGATCTCCTGCCGGGCGTGGTG
GCTCATGCCTGTAATCCCACCACTTTTTTTTTAAGGCAGGCGGATCACCTGAGGTCAGGA
GTTTAAGACCAGCCTGACCAACATGGAGAAACCTCGTCTCTACTAAAAATACAAAAATTA
GCCAGGCATGGTGGCACACGCCTATAGTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAAT
CACTTGAACCCAGGAGGCAGAGGTTGCAGTGAGCTGAGATCACGTCATTGCACTCCATCC
TGAGCCACAAGAGCAAAACTCCGTCTCAAAAAAAAAAAAAGAAGAAGGTGGATCTCCAAC
CAGGCCAGAGAAGATTCTCACAGAAGGTTTTGAACTCTAAGAAATAAATTGGTTTGGTAA
TAAATGGCTTCTGGTCAGAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_003757
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003757.2, NP_003748.1
RefSeq Size 1458 bp
RefSeq ORF 978 bp
Locus ID 8668
UniProt ID Q13347
Cytogenetics 1p35.2
Domains WD40
Summary Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis (PubMed:17581632, PubMed:25849773, PubMed:27462815). The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation (PubMed:17581632). The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression (PubMed:25849773).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_003757" in other vectors (7)
SKU Description Size Price
RC201833 EIF3I (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 3, subunit I (EIF3I) 10 ug
$300.00
RC201833L1 Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit I (EIF3I), Myc-DDK-tagged 10 ug
$600.00
RC201833L2 Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit I (EIF3I), mGFP tagged 10 ug
$600.00
RC201833L3 Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit I (EIF3I), Myc-DDK-tagged 10 ug
$600.00
RC201833L4 Lenti ORF clone of Human eukaryotic translation initiation factor 3, subunit I (EIF3I), mGFP tagged 10 ug
$600.00
RG201833 EIF3I (tGFP-tagged) - Human eukaryotic translation initiation factor 3, subunit I (EIF3I) 10 ug
$489.00 $500.00
SC117777 EIF3I (untagged)-Human eukaryotic translation initiation factor 3, subunit I (EIF3I) 10 ug
$300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products