OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ULK3 (NM_001099436) Human Untagged Clone

Be the first to review this product
SKU
SC316533
ULK3 (untagged)-Human unc-51-like kinase 3 (C. elegans) (ULK3)
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA326685 Rabbit Polyclonal ULK3 Antibody
100 ug
$640.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ULK3 or NM_001099436"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ULK3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC316533 representing NM_001099436.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGGGCCCGGCTGGGGTCCCCCGCGCCTGGACGGCTTCATCCTCACCGAGCGCCTGGGCAGCGGC
ACGTACGCCACGGTGTACAAGGCCTACGCCAAGAAGGACACTCGTGAAGTGGTAGCCATAAAGTGTGTA
GCCAAGAAAAGTCTGAACAAGGCATCGGTGGAGAACCTCCTCACGGAGATTGAGATCCTCAAGGGCATT
CGACATCCCCACATTGTGCAGCTGAAAGACTTTCAGTGGGACAGTGACAATATCTACCTCATCATGGAG
TTTTGCGCAGGGGGCGACCTGTCTCGCTTCATCCATACCCGCAGGATTCTGCCTGAGAAGGTGGCGCGT
GTCTTCATGCAGCAATTAGCTAGCGCCCTGCAATTCCTGCATGAACGGAATATCTCTCACCTGGATCTG
AAGCCACAGAACATTCTACTGAGCTCCTTGGAGAAGCCCCACCTAAAACTGGCAGACTTTGGTTTCGCA
CAACACATGTCCCCGTGGGATGAGAAGCACGTGCTCCGTGGCTCCCCCCTCTACATGGCCCCCGAGATG
GTGTGCCAGCGGCAGTATGACGCCCGCGTGGACCTCTGGTCCATGGGGGTCATCCTGTATGAAGCCCTC
TTCGGGCAGCCCCCCTTTGCCTCCAGGTCGTTCTCGGAGCTGGAAGAGAAGATCCGTAGCAACCGGGTC
ATCGAGCTCCCCTTGCGGCCCCTGCTCTCCCGAGACTGCCGGGACCTACTGCAGCGGCTCCTGGAGCGG
GACCCCAGCCGTCGCATCTCCTTCCAGGACTTTTTTGCGCACCCCTGGGTGGACCTGGAGCACATGCCC
AGTGGGGAGAGTCTGGGGCGAGCAACCGCCCTGGTGGTGCAGGCTGTGAAGAAAGACCAGGAGGGGGAT
TCAGCAGCTGCCTTATCACTCTACTGCAAGGCTCTGGACTTCTTTGTACCTGCCCTGCACTATGAAGTG
GATGCCCAGCGGAAGGAGGCAATTAAGGCAAAGGTGGGGCAGTACGTGTCCCGGGCTGAGGAGCTCAAG
GCCATCGTCTCCTCTTCCAATCAGGCCCTGCTGAGGCAGGGGACCTCTGCCCGAGACCTGCTCAGAGAG
ATGGCCCGGGACAAGCCACGCCTCCTAGCTGCCCTGGAAGTGGCTTCAGCTGCCATGGCCAAGGAGGAG
GCCGCCGGCGGGGAGCAGGATGCCCTGGACCTGTACCAGCACAGCCTGGGGGAGCTACTGCTGTTGCTG
GCAGCGGAGCCCCCGGGCCGGAGGCGGGAGCTGCTTCACACTGAGGTTCAGAACCTCATGGCCCGAGCT
GAATACTTGAAGGAGCAGGTCAAGATGAGGGAATCTCGCTGGGAAGCTGACACCCTGGACAAAGAGGGA
CTGTCGGAATCTGTTCGTAGCTCTTGCACCCTTCAGTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001099436
Insert Size 1419 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001099436.3
RefSeq Size 2644 bp
RefSeq ORF 1419 bp
Locus ID 25989
UniProt ID Q6PHR2
Cytogenetics 15q24.1
Protein Families Druggable Genome, Protein Kinase
Protein Pathways mTOR signaling pathway, Regulation of autophagy
MW 53.4 kDa
Summary Serine/threonine protein kinase that acts as a regulator of Sonic hedgehog (SHH) signaling and autophagy. Acts as a negative regulator of SHH signaling in the absence of SHH ligand: interacts with SUFU, thereby inactivating the protein kinase activity and preventing phosphorylation of GLI proteins (GLI1, GLI2 and/or GLI3). Positively regulates SHH signaling in the presence of SHH: dissociates from SUFU, autophosphorylates and mediates phosphorylation of GLI2, activating it and promoting its nuclear translocation. Phosphorylates in vitro GLI2, as well as GLI1 and GLI3, although less efficiently. Also acts as a regulator of autophagy: following cellular senescence, able to induce autophagy.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longest isoform (a).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001099436" in other vectors (7)
SKU Description Size Price
RC220209 ULK3 (Myc-DDK-tagged)-Human unc-51-like kinase 3 (C. elegans) (ULK3) 10 ug
$457.00
RC220209L1 Lenti ORF clone of Human unc-51-like kinase 3 (C. elegans) (ULK3), Myc-DDK-tagged 10 ug
$757.00
RC220209L2 Lenti ORF clone of Human unc-51-like kinase 3 (C. elegans) (ULK3), mGFP tagged 10 ug
$757.00
RC220209L3 Lenti ORF clone of Human unc-51-like kinase 3 (C. elegans) (ULK3), Myc-DDK-tagged 10 ug
$757.00
RC220209L4 Lenti ORF clone of Human unc-51-like kinase 3 (C. elegans) (ULK3), mGFP tagged 10 ug
$757.00
RG220209 ULK3 (tGFP-tagged) - Human unc-51-like kinase 3 (C. elegans) (ULK3) 10 ug
$657.00
SC323667 ULK3 (untagged)-Kinase deficient mutant (K87M) of Human unc-51-like kinase 3 (C. elegans) (ULK3) 10 ug
$457.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products