OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PITX2 (NM_153427) Human Untagged Clone

Be the first to review this product
SKU
SC306602
PITX2 (untagged)-Human paired-like homeodomain 2 (PITX2), transcript variant 1
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA809670 PITX2 mouse monoclonal antibody,clone OTI1H10 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PITX2 or NM_153427"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PITX2
Synonyms ARP1; ASGD4; Brx1; IDG2; IGDS; IGDS2; IHG2; IRID2; Otlx2; PTX2; RGS; RIEG; RIEG1; RS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC306602 representing NM_153427.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGACCAACTGCCGCAAACTGGTGTCGGCGTGTGTGCAATTAGAGAAAGATAAAAGCCAGCAGGGG
AAGAATGAGGACGTGGGCGCCGAGGACCCGTCTAAGAAGAAGCGGCAAAGGCGGCAGCGGACTCACTTT
ACCAGCCAGCAGCTCCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCGGACATGTCCACACGC
GAAGAAATCGCTGTGTGGACCAACCTTACGGAAGCCCGAGTCCGGGTTTGGTTCAAGAATCGTCGGGCC
AAATGGAGAAAGAGGGAGCGCAACCAGCAGGCCGAGCTATGCAAGAATGGCTTCGGGCCGCAGTTCAAT
GGGCTCATGCAGCCCTACGACGACATGTACCCAGGCTATTCCTACAACAACTGGGCCGCCAAGGGCCTT
ACATCCGCCTCCCTATCCACCAAGAGCTTCCCCTTCTTCAACTCTATGAACGTCAACCCCCTGTCATCA
CAGAGCATGTTTTCCCCACCCAACTCTATCTCGTCCATGAGCATGTCGTCCAGCATGGTGCCCTCAGCA
GTGACAGGCGTCCCGGGCTCCAGTCTCAACAGCCTGAATAACTTGAACAACCTGAGTAGCCCGTCGCTG
AATTCCGCGGTGCCGACGCCTGCCTGTCCTTACGCGCCGCCGACTCCTCCGTATGTTTATAGGGACACG
TGTAACTCGAGCCTGGCCAGCCTGAGACTGAAAGCAAAGCAGCACTCCAGCTTCGGCTACGCCAGCGTG
CAGAACCCGGCCTCCAACCTGAGTGCTTGCCAGTATGCAGTGGACCGGCCCGTGTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_153427
Insert Size 816 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_153427.2
RefSeq Size 3110 bp
RefSeq ORF 816 bp
Locus ID 5308
UniProt ID Q99697
Cytogenetics 4q25
Protein Families Transcription Factors
Protein Pathways TGF-beta signaling pathway
MW 30.3 kDa
Summary This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1), also known as ARP1a, lacks an in-frame exon in the 5' region, as compared to variant 2. The resulting isoform (a) lacks an internal segment, as compared to isoform b. Variants 1 and 6 encode the same isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_153427" in other vectors (6)
SKU Description Size Price
RC210612 PITX2 (Myc-DDK-tagged)-Human paired-like homeodomain 2 (PITX2), transcript variant 1 10 ug
$300.00
RC210612L1 Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC210612L2 Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 1, mGFP tagged 10 ug
$600.00
RC210612L3 Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC210612L4 Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 1, mGFP tagged 10 ug
$600.00
RG210612 PITX2 (tGFP-tagged) - Human paired-like homeodomain 2 (PITX2), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products