PD-L1 (CD274) (NM_014143) Human Untagged Clone
$450.00
5 Days*
Specifications
| Product Data | |
| Type | Human Untagged Clone |
|---|---|
| Target Symbol | PD-L1 |
| Synonyms | B7-H; B7H1; hPD-L1; PD-L1; PDCD1L1; PDCD1LG1; PDL1 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data | |
| Restriction Sites | NotI-NotI | |
| ACCN | NM_014143 |
| Insert Size | 873 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_014143.2, NP_054862.1 |
| RefSeq Size | 1553 bp |
| RefSeq ORF | 873 bp |
| Locus ID | 29126 |
| UniProt ID | Q9NZQ7 |
| Cytogenetics | 9p24.1 |
| Domains | ig, IG |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Cell adhesion molecules (CAMs) |
| Summary | This gene encodes an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Expression of this gene in tumor cells is considered to be prognostic in many types of human malignancies, including colon cancer and renal cell carcinoma. Alternative splicing results in multiple transcript variants. provided by RefSeq, Sep 2015 Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_014143" in other vectors (6)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| RC213071 | PD-L1 / CD274 (Myc-DDK-tagged)-Human PD-L1 / CD274 molecule (PD-L1 / CD274) | 10 ug |
$300.00
|
|
| RC213071L1 | Lenti ORF clone of Human CD274 molecule (CD274), Myc-DDK-tagged | 10 ug |
$600.00
|
|
| RC213071L2 | Lenti ORF clone of Human CD274 molecule (CD274), mGFP tagged | 10 ug |
$600.00
|
|
| RC213071L3 | Lenti ORF clone of Human CD274 molecule (CD274), Myc-DDK-tagged | 10 ug |
$600.00
|
|
| RC213071L4 | Lenti ORF clone of Human CD274 molecule (CD274), mGFP tagged | 10 ug |
$600.00
|
|
| RG213071 | PD-L1 / CD274 (tGFP-tagged) - Human PD-L1 / CD274 molecule (PD-L1 / CD274) | 10 ug |
$489.00
$500.00
|
|
Citations
Development of an Immuno-SPECT/Fluorescent Bimodal Tracer Targeting Human or Murine PD-L1 on Preclinical Models
Privat, Massot, Hermetet et al
J Med Chem (2024) 67 (3), 2188-2201 DOI: 10.1021/acs.jmedchem.3c02120
Privat, Massot, Hermetet et al
J Med Chem (2024) 67 (3), 2188-2201 DOI: 10.1021/acs.jmedchem.3c02120
Cited by 6
Additive effect of CD73 inhibitor in colorectal cancer treatment with CDK4/6 inhibitor through regulation of PD-L1
Noh, Lee, Han et al
Cell Mol Gastroenterol Hepatol (2022) 14 (4), 769-788 DOI: 10.1016/j.jcmgh.2022.07.005
Noh, Lee, Han et al
Cell Mol Gastroenterol Hepatol (2022) 14 (4), 769-788 DOI: 10.1016/j.jcmgh.2022.07.005
Cited by 35
AI Summary: In this study, OriGene products including the anti-CCND1 antibody (TA500249) and PD-L1 antibody (TA592595) were used for western blot and immunohistochemistry analyses to assess protein expression changes in macrophages and tumor tissues, contributing to the investigation of the mechanisms underlying the combined therapeutic effects of CD73 and CDK4/6 inhibitors in colorectal cancer.
Snippet: RC in combination with cetuximab (clinical trial number: NCT03446157), this study could provide helpful information for future clinical trials on refractory CRC. Cyclin D1 plays a central role in tumorigenesis in cancer cells and is an important regulator of the cell cycle.40 In general, cyclin D1 is known for its role in the nucleus, in cell cycle regulation, but it is also located in the cytopl
PD-1+ natural killer cells in human non-small cell lung cancer can be activated by PD-1/PD-L1 blockade
Trefny, Kaiser, Stanczak et al
Cancer Immunol Immunother (2020) 69 (8), 1505-1517 DOI: 10.1007/s00262-020-02558-z
Trefny, Kaiser, Stanczak et al
Cancer Immunol Immunother (2020) 69 (8), 1505-1517 DOI: 10.1007/s00262-020-02558-z
Cited by 89
AI Summary: In this study, OriGene products—specifically the anti-PD-1 antibody (Cat# TA347127) and PD-L1 expression plasmid (Cat# RC217445)—were used to detect PD-1 on NK cells and to induce PD-L1 expression in tumor cells, enabling the researchers to investigate how PD-1/PD-L1 interactions affect NK cell function in non-small cell lung cancer.
PD-1+ natural killer cells in human non-small cell lung cancer can be activated by PD-1/PD-L1 blockade
Trefny, Kaiser, Stanczak et al
Cancer Immunol Immunother (2020)
Trefny, Kaiser, Stanczak et al
Cancer Immunol Immunother (2020)
Cited by 89
AI Summary: OriGene products pCMV6 human cDNA clone (RC210364) and pCMV-XL4 human cDNA clone (SC115168) were used as sources of PD-1 and PD-L1 open reading frames for cloning expression vectors in this study.
Snippet: Cloning of PD‑1 and PD‑L1 expression vectors The human PD-1/PD-L1 open reading frames (ORFs) were amplified by PCR from a pCMV6 human cDNA clone (RC210364, Origene) and a pCMV-XL4 human cDNA clone (SC115168, Origene), respectively;- Cloning of PD‑1 and PD‑L1 expression vectors The human PD-1/PD-L1 open reading frames (ORFs) were amplified by PCR from a pCMV6 human cDNA clone (RC210364, Origene) and a pCMV-XL4 human cDNA clone (SC115168, Origene), respectively
BRAFV600E-induced, tumor intrinsic PD-L1 can regulate chemotherapy-induced apoptosis in human colon cancer cells and in tumor xenografts
Feng, Qin, Pal et al
Oncogene (2019) 38 (41), 6752-6766 DOI: 10.1038/s41388-019-0919-y
Feng, Qin, Pal et al
Oncogene (2019) 38 (41), 6752-6766 DOI: 10.1038/s41388-019-0919-y
AI Summary: OriGene’s human PD-L1 cDNA (catalog no. sc115168) was used as a template to restore PD-L1 expression in experimental colon cancer cells, enabling the study of PD-L1’s role in regulating chemotherapy-induced apoptosis.
Snippet: Human PD-L1 (CD274) guide RNA (target sequence TACCGCTGCATGATCAGCTA) cloned in lentiviral vector pLentiCRISPRv2 was purchased from GenScript. Lentiviral BRAFV600E, doxycycline-inducible mutant KRAS [17], and wt BIM were previously described [17]. Human PD-L1 complementary DNA template was obtained from Origene (Rockville, MD, catalog no. sc115168) and subcloned into vector pCDH1-puro-2HA
Human CAR T cells with cell-intrinsic PD-1 checkpoint blockade resist tumor-mediated inhibition
Cherkassky, Morello, Villena-Vargas et al
J. Clin. Invest. (2016) 126 (8), 3130-44 DOI: 10.1172/JCI83092
Cherkassky, Morello, Villena-Vargas et al
J. Clin. Invest. (2016) 126 (8), 3130-44 DOI: 10.1172/JCI83092
Cited by 1
Showing 1-6 of 7 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
