OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Gata2 (NM_008090) Mouse Untagged Clone

Be the first to review this product
SKU
MC216629
Gata2 (untagged) - Mouse GATA binding protein 2 (Gata2), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Gata2 or NM_008090"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Gata2
Synonyms Gata-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC216629 representing NM_008090
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGTGGCGCCTGAGCAGCCTCGCTGGATGGCGCACCCCGCCGTATTGAATGCGCAGCACCCCGACT
CGCACCATCCGGGCCTGGCGCATAACTACATGGAGCCAGCACAGCTGCTGCCTCCCGACGAGGTGGATGT
CTTCTTCAACCATCTCGACTCGCAGGGCAACCCTTACTACGCCAACCCGGCCCACGCGCGCGCGCGCGTT
TCCTACAGCCCGGCGCATGCCCGTCTCACCGGAGGCCAGATGTGCCGACCACACTTGTTGCACAGCCCAG
GCTTGCCGTGGCTGGACGGGGGCAAAGCAGCTCTCTCTGCCGCCGCTGCCCATCACCACAGTCCCTGGAC
CGTCAGCCCGTTCTCCAAGACCCCGCTGCACCCCTCAGCTGCTGGAGCACCCGGAGGGCCTCTGTCTGTT
TACCCAGGGGCTGCGGGTGGGAGCGGGGGAGGCAGTGGGAGCTCCGTGGCCTCCCTCACCCCCACTGCAG
CCCACTCGGGCTCCCATCTCTTCGGCTTCCCACCCACGCCACCCAAAGAAGTGTCTCCAGACCCCAGCAC
AACAGGAGCTGCTTCCCCGGCCTCTTCTTCTGCAGGGGGTAGTGTAGCCCGGGGTGAGGACAAGGATGGC
GTCAAGTACCAAGTGTCACTCTCCGAGAGCATGAAGATGGAAGGCGGCAGTCCCCTGCGCCCGGGCCTAG
CTACCATGGGCACCCAGCCTGCAACACACCACCCGATACCCACCTATCCCTCCTATGTGCCCGCCGCAGC
TCATGACTATGGCAGCAGTCTCTTCCATCCAGGAGGCTTCCTGGGTGGCCCCGCCTCCAGCTTCACCCCT
AAGCAGAGAAGCAAGGCTCGCTCCTGCTCAGAAGGCCGGGAGTGTGTCAACTGTGGTGCCACAGCCACCC
CTCTCTGGCGACGAGATGGCACGGGCCACTACCTGTGCAATGCCTGTGGGCTCTACCACAAGATGAATGG
ACAGAACCGGCCGCTCATCAAGCCCAAGCGGAGGCTGTCTGCTGCCAGAAGAGCGGGCACCTGTTGTGCA
AATTGTCAGACGACAACCACCACCTTATGGCGCCGGAACGCCAACGGGGACCCTGTGTGCAACGCCTGTG
GCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACCCGGAA
TCGGAAGATGTCCAGCAAATCCAAGAAGAGCAAGAAAGGGGCTGAATGTTTCGAGGAGCTCTCCAAGTGC
ATGCAAGAGAAGTCACCGCCCTTCAGTGCGGCTGCCCTGGCTGGACACATGGCACCTGTGGGACACCTCC
CACCTTTTAGTCACTCTGGACACATCCTACCCACGCCCACGCCTATCCACCCTTCCTCCAGTCTCTCTTT
TGGCCACCCCCACCCGTCCAGCATGGTGACTGCCATGGGCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_008090
Insert Size 1443 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC107009, AAI07010
RefSeq Size 2347 bp
RefSeq ORF 1443 bp
Locus ID 14461
UniProt ID O09100
Cytogenetics 6 39.2 cM
Summary Transcriptional activator which regulates endothelin-1 gene expression in endothelial cells. Binds to the consensus sequence 5'-AGATAG-3'.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008090" in other vectors (4)
SKU Description Size Price
MG226728 Gata2 (tGFP-tagged) - Mouse GATA binding protein 2 (Gata2), (10ug) 10 ug
$657.00
MR226728 Gata2 (Myc-DDK-tagged) - Mouse GATA binding protein 2 (Gata2) 10 ug
$289.00 $457.00
MR226728L3 Lenti ORF clone of Gata2 (Myc-DDK-tagged) - Mouse GATA binding protein 2 (Gata2) 10 ug
$757.00
MR226728L4 Lenti ORF clone of Gata2 (mGFP-tagged) - Mouse GATA binding protein 2 (Gata2) 10 ug
$757.00

file-alt Citations

Endothelin-1 Augments Therapeutic Potency of Human Mesenchymal Stem Cells via CDH2 and VEGF Signaling
Lee, Hwang, Kim et al
Mol Ther Methods Clin Dev (2019) 13, 503-511 DOI: 10.1016/j.omtm.2019.05.003
Cited by 9
AI Summary: OriGene products contributed to this study by providing the human CDH2 promoter reporter plasmid (Cat# HPRM15713) and human GATA2 and MZF1 expression plasmids (Cat# RC212921 and RC216506, respectively), which were used to investigate the transcriptional regulation of CDH2 by EDN1 in human mesenchymal stem cells.
FigureFigureFigure
Lethal Influenza in Two Related Adults with Inherited GATA2 Deficiency
Sologuren, Martínez-Saavedra, Solé-Violán et al
J. Clin. Immunol. (2018) 38 (4), 513-526 DOI: 10.1007/s10875-018-0512-0
AI Summary: OriGene products GATA2-WT isoform 1 (RC208554) and GATA2-WT isoform 2 (RC208514) were used as expression vectors in HEK293T cells to assess the functional impact of GATA2 mutations via Western blot analysis in this study.
Snippet: Western blots of GATA2 were performed on HEK293T cells transfected with vectors containing GATA2-WT isoform 1 (Origene RC208554) and GATA2-WT isoform 2 (Origene RC208514);mutated vectors containing the variants R396L, R396Q, and R398W were generated
Transcriptional activation of prostate specific homeobox gene NKX3-1 in subsets of T-cell lymphoblastic leukemia (T-ALL)
Nagel, Ehrentraut, Tomasch et al
PLoS ONE (2012) 7 (7), e40747 DOI: 10.1371/journal.pone.0040747
Cited by 18
AI Summary: OriGene products contributed to this study by providing pCMV6-based expression constructs for LYL1, GATA2, GATA3, MSX2, and NKX3-1, which were used to investigate the transcriptional regulation mechanisms of NKX3-1 in T-ALL cell lines.
Snippet: described previously [15], [29]. Expression constructs for LYL1, GATA2, GATA3, MSX2, and NKX3-1 have been cloned in vector pCMV6 and were obtained from Origene (Wiesbaden, Germany). SiRNA oligonucleotides (siFOXA1
FigureFigureFigure
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products