OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Adrb3 (NM_013462) Mouse Untagged Clone

Be the first to review this product
SKU
MC208113
Adrb3 (untagged) - Mouse adrenergic receptor, beta 3 (Adrb3), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA328711 Rabbit Polyclonal Anti-beta3-Adrenoceptor (extracellular)
50 ul
$1,145.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Adrb3 or NM_013462"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Adrb3
Synonyms Adrb-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208113 representing NM_013462
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCCGTGGCCTCACAGAAACGGCTCTCTGGCTTTGTGGTCGGACGCCCCTACCCTGGACCCCAGTG
CAGCCAACACCAGTGGGTTGCCAGGAGTACCATGGGCAGCGGCATTGGCTGGGGCATTGCTGGCGCTGGC
CACGGTGGGAGGCAACCTGCTGGTAATCATAGCCATCGCCCGCACGCCGAGACTACAGACCATAACCAAC
GTGTTCGTGACTTCACTGGCCGCAGCTGACTTGGTAGTGGGACTCCTCGTAATGCCACCAGGGGCCACAT
TGGCGCTGACTGGCCATTGGCCCTTGGGCGAAACTGGTTGCGAACTGTGGACGTCAGTGGACGTGCTCTG
TGTAACTGCTAGCATCGAGACCTTGTGCGCCCTGGCTGTGGACCGCTACCTAGCTGTCACCAACCCTTTG
CGTTACGGCACGCTGGTTACCAAGCGCCGCGCCCGCGCGGCAGTTGTCCTGGTGTGGATCGTGTCCGCTG
CCGTGTCCTTTGCGCCCATCATGAGCCAGTGGTGGCGTGTAGGGGCAGATGCCGAGGCACAGGAATGCCA
CTCCAATCCGCGCTGCTGTTCCTTTGCCTCCAACATGCCCTATGCGCTGCTCTCCTCCTCCGTCTCCTTC
TACCTTCCCCTCCTTGTGATGCTCTTCGTCTATGCTCGAGTGTTCGTTGTGGCTAAGCGCCAACGGCATT
TGCTGCGCCGGGAACTGGGCCGCTTCTCGCCCGAGGAGTCTCCGCCGTCTCCGTCGCGCTCTCCGTCCCC
TGCCACAGGCGGGACACCCGCGGCACCGGATGGAGTGCCCCCCTGCGGCCGGCGGCCTGCGCGCCTCCTG
CCACTCCGGGAACACCGCGCCCTGCGCACCTTAGGTCTCATTATGGGCATCTTCTCTCTGTGCTGGCTGC
CCTTCTTCCTGGCCAACGTGCTGCGCGCACTCGCGGGGCCCTCTCTAGTTCCCAGCGGAGTTTTCATCGC
CCTGAACTGGCTGGGCTATGCCAACTCCGCCTTCAACCCGGTCATCTACTGCCGCAGCCCGGACTTTCGC
GACGCCTTCCGTCGTCTTCTGTGTAGCTACGGTGGCCGTGGACCGGAGGAGCCACGCGCAGTCACCTTCC
CAGCCAGCCCTGTTGAAGCCAGGCAGAGTCCACCGCTCAACAGGTTTGATGGCTATGAAGGTGCGCGTCC
GTTTCCCACGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_013462
Insert Size 1203 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013462.3, NP_038490.2
RefSeq Size 2795 bp
RefSeq ORF 1203 bp
Locus ID 11556
UniProt ID P25962
Cytogenetics 8 15.94 cM
Summary Beta-adrenergic receptors mediate the catecholamine-induced activation of adenylate cyclase through the action of G proteins. Beta-3 is involved in the regulation of lipolysis and thermogenesis.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_013462" in other vectors (4)
SKU Description Size Price
MG225687 Adrb3 (tGFP-tagged) - Mouse adrenergic receptor beta 3 (Adrb3), (10ug) 10 ug
$489.00 $657.00
MR225687 Adrb3 (Myc-DDK-tagged) - Mouse adrenergic receptor, beta 3 (Adrb3) 10 ug
$289.00 $457.00
MR225687L3 Lenti ORF clone of Adrb3 (Myc-DDK-tagged) - Mouse adrenergic receptor, beta 3 (Adrb3) 10 ug
$757.00
MR225687L4 Lenti ORF clone of Adrb3 (mGFP-tagged) - Mouse adrenergic receptor, beta 3 (Adrb3) 10 ug
$757.00

file-alt Citations

Vascular rarefaction mediates whitening of brown fat in obesity
Shimizu, Aprahamian, Kikuchi et al
J. Clin. Invest. (2014)
AI Summary: OriGene products contributed to this study by providing plasmid-encoded Adrb1 (MC216246) and Adrb3 (MC208113), which were used to generate standard curves for precise quantification of Adrb1 and Adrb3 mRNA copy numbers.
Snippet: For most transcripts, the relative levels of mRNA were determined using the ΔΔCT method, normalizing to Actb. For Adrb1 and Adrb3, copy number was determined by generating a 6-point standard curve using plasmid-encoded Adrb1 (MC216246;Origene) or Adrb3 (MC208113;Origene)
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products