Nudt1 (NM_008637) Mouse Untagged Clone

SKU MC204305

Nudt1 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 1 (Nudt1), (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Nudt1
• Synonyms: Mth1
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC021940; CGGACGCGTCCGCCCACGCGTCCGCCGCCCCGGGAAACTTTGGCTGGGGCGCGAAGGACCCAGGAGAGCA TGAGCACCTCCAGGCTTTATACCCTTGTGCTAGTGCTACAGCCTCAGCGAGTTCTCCTGGGCATGAAGAA GAGGGGCTTTGGTGCTGGCCGCTGGAATGGCTTCGGGGGCAAGGTGCAGGAAGGAGAGACCATTGAGGAT GGGGCTAAGAGAGAGCTGCTGGAAGAAAGTGGTCTGAGCGTGGATACACTGCACAAGGTAGGCCACATCT CGTTTGAATTTGTGGGCTCCCCTGAGCTGATGGACGTGCATATCTTCTCGGCTGACCATGTGCACGGGAC GCCCACAGAGAGTGAAGAAATGCGCCCTCAGTGGTTCCAACTGGACCAGATCCCCTTTGCCGACATGTGG CCGGATGACAGCTACTGGTTCCCACTCCTGCTTCAGAAGAAGAAGTTCTGTGGGCACTTCAAGTTCCAGG ATCAGGACACGATCCTCAGTTACTCGCTGCGAGAGGTGGACTCATTCTAATACAGAACTCTGGCTGGTTC TGGCCACTCAGGATGCTACACAGCCGCAAGCTGTCGGACCAAGGGCACAAGCAGGGGCTGGTATTTTCTG TGTGCGAGGGGTTGGGGTTGAAATGTGAAATGTCACCAATACACCAATGTTTGAATTCTTCGTCCCCACA TACTGGTCCTGTTTTAGAAGGTTGTGGCACCTTTAAGAGCCAGAGCCCTGCTGGTGGAACTGAGTCACTG GGGATCGGAGAATGGAGGATGGGCCTTGCTTTATAGGTGAGCACCGCTTACTGTCTGCTCACACTCCGGC TACTGTGTCAGATTTTCCACGATGGACTGTGTCCCCAGATGGATGAGCTGAAATAAACCGTTGCTCCTCT AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_008637
• Insert Size: 471 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: BC021940, AAH21940
• RefSeq Size: 975 bp
• RefSeq ORF: 471 bp
• Locus ID: 17766
• UniProt ID: P53368
• Cytogenetics: 5 G2
• Summary: Antimutagenic (PubMed:11572992). Plays a redundant role in sanitizing oxidized nucleotide pools, such as 8-oxo-dGTP pools (PubMed:29281266). Acts as a sanitizing enzyme for oxidized nucleotide pools, thus suppressing cell dysfunction and death induced by oxidative stress. Hydrolyzes 8-oxo-dGTP, 8-oxo-dATP and 2-OH-dATP, thus preventing misincorporation of oxidized purine nucleoside triphosphates into DNA and subsequently preventing A:T to C:G and G:C to T:A transversions. Able to hydrolyze also the corresponding ribonucleotides, 2-OH-ATP, 8-oxo-GTP and 8-oxo-ATP (By similarity). Does not play a role in U8 snoRNA decapping activity (PubMed:21070968). Binds U8 snoRNA (PubMed:21070968).[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (1) represents the predominant transcript. All four variants encode the same protein.