OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Fezf2 (NM_080433) Mouse Untagged Clone

Be the first to review this product
SKU
MC202571
Fezf2 (untagged) - Mouse Fez family zinc finger 2 (Fezf2), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Fezf2 or NM_080433"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fezf2
Synonyms AI451466; AI852056; Fez; Fezl; Zfp312
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC055718 sequence for NM_080433
GGCGCGCCATGGCCAGCTCAGCTTCCCTGGAGACCATGGTGCCCCCGGCCTGCCCGCGCGCTGGAGCGTC
ACCGGCCACTTCTAAAACACTAGCTTTCTCTATCGAGCGCATCATGGCCAAGACGTCCGAGCCCCGAGCG
CCTTTCGAGCCCCGGCCTGCTGCGTTAGAGGCAGACAGCAGCCAGAGCAAGAAACTGCTCAACCTCTGCT
CGCCGCTGCCCTGTATGATCCCTCTCCAGCCTCTAGGCTACGAGGTGCCGTCCAAGACGCTGCTCAGTTA
CTCGGAGTTCTGGAAGAGCAGCCTCCGGGCGGGCGGCGGTGGAGGAGGAGGCAGCGGCGGGGGGGCCCCA
GTGTGCGGCGCCAGCGGCTTGTGCAAAACCAACTGTGGCGTGTGCTGCAAGGCCGAACTGGGCCTCGCGC
CTTCTGCGCTGCCCGCCGGCAGGGTCATCAAACCGCAGGTCATCAACCAGGCTGTGGGGCTGCCTGCCAG
CGGCTCTCTCTACTACTTCAACTACCTGGACTCCACCGCTTACCCACCTTCGGAGCTCCTCGGAGGCCAC
CTTTTCCCATCCGGCCTCCTCAACGCACAGGCCCCCACTTCCCTGGCTGCTCACCCCAAGCTTTTTCTGC
TGGAGAACGCCAAACTGGCCAGCCTGGCTGCGGACAAGTTCCCCCACCCAGCTTCCTATCCCCATAAGGA
GCGCTTGCATGCGCCACTGGAGCAGGTGCTGAAGGAGAACTCGGCCTTGACAGCTGAACGAGGGGGAGTC
AAGAGCCACAGCAAACTACCGGGGGGCTCTACTGACAGCAAACCCAAAAACTTCACCTGCGAAGTGTGCG
GCAAGGTGTTCAATGCTCACTATAACCTCACCCGCCACATGCCTGTCCACACCGGAGCTAGACCGTTTGT
GTGCAAAGTCTGTGGCAAAGGCTTCCGCCAGGCCAGCACTCTCTGCAGACACAAAATTATCCATACCCAG
GAAAAACCACATAAGTGTAACCAGTGCGGCAAAGCCTTCAATCGCAGCTCCACGCTCAACACGCACATCC
GCATCCACGCGGGCTACAAGCCCTTCGTCTGCGAGTTTTGTGGCAAAGGCTTTCACCAAAAAGGGAACTA
CAAGAATCACAAGCTCACCCACAGCGGCGAGAAGCAGTACAAATGCACTATCTGTAACAAGGCCTTCCAT
CAGGTCTACAATCTGACCTTCCACATGCACACCCACAACGACAAGAAGCCTTTCACGTGTGCCACTTGCG
GCAAAGGTTTTTGCAGAAACTTTGACTTAAAGAAACATGTGCGCAAACTTCATGACAGCGTGGGTCCCAC
CGCCACCCCCTCAGCAAAGGACCTAGCCAGGACAGTTCAGAGCTGAGAGCTACTGCCTTGTCCGTTCTTC
CTGCCCTGTACCAACCCAAGCAGATCTCACGTATAAACTTATTTCTAAAATTAAAAGAAAAAAAAACTAT
AAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI |
ACCN NM_080433
Insert Size 1368 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC055718, AAH55718
RefSeq Size 2149 bp
RefSeq ORF 1368 bp
Locus ID 54713
UniProt ID Q9ESP5
Cytogenetics 14 A1
Summary Transcription repressor. Required for the specification of corticospinal motor neurons and other subcerebral projection neurons. May play a role in layer and neuronal subtype-specific patterning of subcortical projections and axonal fasciculation. Controls the development of dendritic arborization and spines of large layer V pyramidal neurons. Plays a role in rostro-caudal patterning of the diencephalon and in prethalamic formation.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_080433" in other vectors (4)
SKU Description Size Price
MG207270 Fezf2 (tGFP-tagged) - Mouse Fez family zinc finger 2 (Fezf2) 10 ug
$657.00
MR207270 Fezf2 (Myc-DDK-tagged) - Mouse Fez family zinc finger 2 (Fezf2) 10 ug
$289.00 $457.00
MR207270L3 Lenti ORF clone of Fezf2 (Myc-DDK-tagged) - Mouse Fez family zinc finger 2 (Fezf2) 10 ug
$757.00
MR207270L4 Lenti ORF clone of Fezf2 (mGFP-tagged) - Mouse Fez family zinc finger 2 (Fezf2) 10 ug
$757.00

file-alt Citations

Temporal control of cortico-thalamic neuron specification by regulation of Neurogenin activity and Polycomb repressive complexes
Oishi, van den Berg, Guillemot
bioRxiv (2018)
Snippet: The Neurog2 expression vector was described previously (Heng et al., 2008). Fezf2 cDNA (MC202571, Origene) and Foxp2 cDNA (IMAGE ID 6851153, Source Bioscience) were subcloned into a pCAGGS plasmid. The Neurog2-binding regions were amplified by PCR from the mouse genome and subcloned into pGL4.23 to obtain firefly luciferase reporter constructs
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products