OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Hsf1 (NM_008296) Mouse Untagged Clone

Be the first to review this product
SKU
MC200965
Hsf1 (untagged) - Mouse heat shock factor 1 (Hsf1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $469.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA355857 HSF1 Antibody - C-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Hsf1 or NM_008296"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Hsf1
Synonyms AA960185; Hsf1alpha; Hsf1beta; HSTF
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC013716 sequence for NM_008296
CGCCGGTCGCAAGATGGCTGCGGCCATGCGAGGCCTTGCTGTGTGTGCGCAGCGGGCGGCGGAGCGGCCC GGACGGCAGGGGCAGCGACGACACTAGCTCAGCCTTCAGCCACTCTTCTAAAAGGCCACCCCAGCCTCTG CCTGCTTTCGTCCGAGATGGATCTGGCCGTGGGCCCCGGTGCAGCGGGGCCCAGCAACGTCCCGGCCTTC CTAACCAAGCTGTGGACCCTCGTGAGCGACCCGGACACAGACGCGCTCATCTGCTGGAGCCCGAGTGGGA ACAGCTTCCACGTGTTTGACCAGGGCCAGTTTGCCAAGGAGGTGCTGCCCAAGTACTTCAAGCACAACAA CATGGCTAGCTTCGTGCGGCAGCTCAACATGTATGGCTTCCGAAAAGTAGTCCACATTGAGCAGGGTGGC CTGGTCAAGCCTGAGAGAGATGACACCGAGTTCCAGCATCCTTGTTTCTTGCGTGGACAGGAACAGCTCC TTGAGAACATCAAGAGGAAAGTGACCAGCGTGTCCACCCTGAAGAGTGAGGACATAAAAATACGCCAGGA CAGTGTCACCCGGCTGTTGACAGATGTGCAGCTGATGAAGGGGAAACAGGAGTGTATGGACTCCAAGCTC CTGGCCATGAAGCACGAGAACGAGGCCCTGTGGCGGGAGGTGGCCAGCCTTCGGCAGAAGCATGCCCAGC AGCAAAAAGTTGTCAACAAGCTCATTCAGTTCCTGATCTCACTGGTGCAGTCGAACCGGATCCTGGGGGT GAAGAGAAAGATCCCTCTGATGTTGAGTGACAGCAACTCAGCACACTCTGTGCCCAAGTATGGTCGACAG TACTCCCTGGAGCATGTCCATGGTCCTGGCCCATACTCAGCTCCATCTCCAGCCTACAGCAGCTCTAGCC TTTACTCCTCTGATGCTGTCACCAGCTCTGGACCCATAATCTCCGATATCACTGAGCTGGCTCCCACCAG CCCTTTGGCCTCCCCAGGCAGGAGCATAGATGAGAGGCCTCTGTCCAGCAGCACTCTGGTCCGTGTCAAG CAAGAGCCCCCCAGCCCACCTCACAGCCCTCGGGTACTGGAGGCGAGCCCTGGGCGCCCATCCTCCATGG ATACCCCTTTGTCCCCAACTGCCTTCATTGACTCCATCCTTCGAGAGAGCGAGCCTACCCCTGCTGCCTC AAACACAGCCCCTATGGACACAACCGGAGCCCAAGCCCCCGCACTCCCGACCCCCTCCACCCCTGAGAAG TGCCTCAGCGTAGCCTGCCTAGACAAGAACGAGCTAAGTGATCACCTGGATGCCATGGACTCCAACCTGG ACAACCTGCAGACCATGCTGACAAGCCACGGCTTCAGTGTGGACACCAGTGCCCTGCTGGACATTCAGGA GCTTCTGTCTCCACAAGAGCCTCCCAGGCCTATTGAGGCAGAGAACAGTAACCCCGACTCAGGAAAGCAG CTGGTGCACTACACGGCTCAGCCTCTGTTCCTGCTGGATCCTGATGCTGTGGACACAGGGAGCAGTGAGC TGCCTGTGCTCTTTGAGCTGGGGGAGAGCTCCTACTTCTCTGAGGGGGATGACTACACGGATGATCCCAC CATCTCTCTTCTGACAGGCACTGAACCCCATAAAGCCAAGGACCCCACTGTCTCCTAGAGCTCTCAGGAG TTGTCAGGCTGGCTTGTGCCTGGCCCCCAACCTATCCCTAGGACATGGCTGGTCCTAGGGAGACAAAACA GTTGGGTAGTCCAGGGGACCCTAGGTCAAGCCACCACAACCCCAGTGGAGCACAGATGGAACTTGGTCCT GGGCAGTACCTTGGATCAGGAGGAAGATCCTGAGGGCTGCATACCTGCTGCCTTTACCCCAGCCCCAGGT CTACTCTCTGGTCACAGCTTCACAGCCACACTTGGACTGACCCTGCAGGTTGTTCATAAAATTGTATTTT GGATTTTTACATGAGAGTCCCCTTTAACCCTTCACAAATAAATATATATATACATACAAAAAAAAAAAAA AA
Restriction Sites RsrII-NotI |
ACCN NM_008296
Insert Size 1512 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC013716, AAH13716
RefSeq Size 2032 bp
RefSeq ORF 1512 bp
Locus ID 15499
UniProt ID P38532
Cytogenetics 15 35.95 cM
Summary Function as a stress-inducible and DNA-binding transcription factor that plays a central role in the transcriptional activation of the heat shock response (HSR), leading to the expression of a large class of molecular chaperones heat shock proteins (HSPs) that protect cells from cellular insults' damage. In unstressed cells, is present in a HSP90-containing multichaperone complex that maintains it in a non-DNA-binding inactivated monomeric form. Upon exposure to heat and other stress stimuli, undergoes homotrimerization and activates HSP gene transcription through binding to site-specific heat shock elements (HSEs) present in the promoter regions of HSP genes. Activation is reversible, and during the attenuation and recovery phase period of the HSR, returns to its unactivated form. Binds to inverted 5'-NGAAN-3' pentamer DNA sequences. Binds to chromatin at heat shock gene promoters. Plays also several other functions independently of its transcriptional activity. Involved in the repression of Ras-induced transcriptional activation of the c-fos gene in heat-stressed cells. Positively regulates pre-mRNA 3'-end processing and polyadenylation of HSP70 mRNA upon heat-stressed cells in a symplekin (SYMPK)-dependent manner. Plays a role in nuclear export of stress-induced HSP70 mRNA. Plays a role in the regulation of mitotic progression. Plays also a role as a negative regulator of non-homologous end joining (NHEJ) repair activity in a DNA damage-dependent manner. Involved in stress-induced cancer cell proliferation in a IER5-dependent manner.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (4) lacks two alternate in-frame exons in the 3' coding region, compared to variant 1. It encodes isoform beta which is shorter compared to isoform gammaalpha.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008296" in other vectors (6)
SKU Description Size Price
MG208087 Hsf1 (tGFP-tagged) - Mouse heat shock factor 1 (Hsf1) 10 ug
$489.00 $668.00
MR208087 Hsf1 (Myc-DDK-tagged) - Mouse heat shock factor 1 (Hsf1) 10 ug
$289.00 $468.00
MR208087L1 Lenti ORF clone of Hsf1 (Myc-DDK-tagged) - Mouse heat shock factor 1 (Hsf1) 10 ug
$768.00
MR208087L2 Lenti ORF clone of Hsf1 (mGFP-tagged) - Mouse heat shock factor 1 (Hsf1) 10 ug
$768.00
MR208087L3 Lenti ORF clone of Hsf1 (Myc-DDK-tagged) - Mouse heat shock factor 1 (Hsf1) 10 ug
$768.00
MR208087L4 Lenti ORF clone of Hsf1 (mGFP-tagged) - Mouse heat shock factor 1 (Hsf1) 10 ug
$768.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products