OriGene Logo

Human MSH3 activation kit by CRISPRa

Be the first to review this product
SKU
GA102978
MSH3 CRISPRa kit - CRISPR gene activation of human mutS homolog 3
  $1,657.00
3 Weeks*

Frequently Bought Together (2)

TA323011 Anti-MSH3 Rabbit Polyclonal Antibody
100 ul
$305.00
RC212391 MSH3 (Myc-DDK-tagged)-Human mutS homolog 3 (E. coli) (MSH3)
10 ug
$1,484.00

Other products for "MSH3"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol MSH3
Locus ID 4437
Components

GA102978G1, MSH3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGCCTCGCCTGCACAAAT

GA102978G2, MSH3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTGCTGTAACGAGCGGGCT

GA102978G3, MSH3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGAACGCGCGGTCAAGTT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_002439
UniProt ID P20585
Synonyms DUP; FAP4; MRP1
Summary The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. provided by RefSeq, Mar 2011
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
Other Versions
SKU Description Size Price
KN412391 MSH3 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img
 

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.