OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TissueScan, Cancer Survey cDNA Array 4X96 - III

Be the first to review this product
SKU
CSRT103
CSRT102 in 96 well format: 381 samples covering 22 different cancers. Available in 2, 5, 10 identical plates.
  $2,120.00
2 Weeks*

Frequently Bought Together (4)

D11-18 Polink-1 HRP Polymer Detection for MOUSE and RABBIT antibodies on human tissue
18 ml
$420.00
D12-6 Polink-1 HRP Polymer Detection for MOUSE antibody on human or animal tissue (non-rodent)
6 ml
$250.00
HP205798 qSTAR qPCR primer pairs against Homo sapiens gene GAPDH 200 reactions
$150.00
MP205604 qSTAR qPCR primer pairs against Mus musculus gene Gapdh 200 reactions
$150.00
Specifications
Specifications
Product Data
TissueScan Type Cancer Survey
Array Name Cancer Survey cDNA Array 4X96 - III
Clinical Info
Diagnosis Category Multiple
Tissue Multiple
Shipping Ambient
Description CSRT102 in 96 well format: 381 samples covering 22 different cancers. Available in 2, 5, 10 identical plates.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Characterization of therapeutic antibodies targeting lymphatic and vascular resistance factor for the treatment of hypervascularized and highly metastatic cancers
David, Karaulic, Bennetot et al
Mol Oncol (2026)
Snippet: forms containing the specific LVRF sequence 5′‐CCTTTGTTTTCCATTTCCCTCAG‐3′ were examined. Independent validation of LVRF expression was performed using TissueScan Cancer Survey cDNA arrays (OriGene Technologies, CSRT103), following the manufacturer's instructions. Quantitative PCR (qPCR) was conducted using primers designed to specifically amplify the human LVRF isoform. (LVRF‐F: CCTTT
Design, Synthesis, and Characterization of a Paclitaxel Formulation Activated by Extracellular MMP9
Ehrsam, Sieber, Oufir et al
Bioconjug Chem (2020) 31 (3), 781-793 DOI: 10.1021/acs.bioconjchem.9b00865
Cited by 10
AI Summary: In this study, OriGene’s MMP9 ELISA Kit (EA100503) and MMP9 qPCR primers (HP208034) were used to quantify MMP9 enzyme levels and mRNA expression, respectively, aiding in the selection and characterization of the in vitro cancer cell model for testing the MMP9-activated paclitaxel formulation.
PDMS-PMOXA-Nanoparticles Featuring a Cathepsin B-Triggered Release Mechanism
Ehrsam, Porta, Hussner et al
Materials (Basel) (2019) 12 (17) DOI: 10.3390/ma12172836
AI Summary: OriGene's cDNA array (CSRT103) was used in this study to analyze CTSB mRNA expression in cancer tissue and cell lines, enabling assessment of cathepsin B as a trigger for the nanoparticle drug release mechanism.
Snippet: 2.2. Quantitative PCR for Gene Expression Analysis in Cancer Tissue Samples and Representative Cell Lines. To determine CTSB mRNA expression in cancer tissue a cDNA array (CSRT103, Origene, Rockville, MD, USA) was commercially obtained Cached
FigureFigureFigure
Homo- and heterodimerization is a common feature of the solute carrier family SLC10 members
Noppes, Müller, Bennien et al
Biol. Chem. (2019)
AI Summary: OriGene’s TissueScan human major tissue qPCR panel was used in this study to analyze the mRNA expression levels of SLC10A1-SLC10A7 across various human tissues by real-time PCR.
Snippet: The TissueScan human major tissue qPCR panel (OriGene, Rockville, MD, USA) was used for mRNA expression analysis of SLC10A1-SLC10A7 by real-time PCR. Beta-2-microglobuline (B2M) and glyceraldehyde3-phosphate dehydrogenase (GAPDH) were used as endogenous controls. Relative gene expression analysis was performed by real-time PCR amplification on an ABI PRISM 7300 thermal cycler (Applied Biosystems, ...
ZFP91 zinc finger protein expression pattern in normal tissues and cancers
Paschke, Jopek, Szyszka et al
Oncol Lett (2019) 17 (3), 3599-3606 DOI: 10.3892/ol.2019.9963
Cited by 8
AI Summary: OriGene’s Cancer Survey cDNA sets were used in this study to analyze ZFP91 mRNA expression across 15 normal human organs and 17 cancer types, enabling the comprehensive characterization of ZFP91 expression patterns in both normal and cancerous tissues.
ZFP91 zinc finger protein expression pattern in normal tissues and cancers
Paschke, Jopek, Szyszka et al
Oncol Lett (2019)
AI Summary: OriGene's Cancer Survey cDNA Arrays I, II, and III (CSRT101, CSRT103, CSRT104) were used to provide 573 cDNA samples from various human normal tissues and cancers, enabling comprehensive analysis of ZFP91 expression patterns in this study.
Snippet: Materials and methods Prostate cancer cDNA samples. Cancer Survey cDNA Arrays I, II and III (CSRT101, CSRT103, CSRT104) from OriGene Technologies (Rockville, USA) were utilized providing 573 cDNA samples from a variety of human normal tissues and cancer
Showing 1-6 of 19 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products