GAPDH Human qPCR Primer Pair (NM_002046)

SKU HP205798

qSTAR qPCR primer pairs against Homo sapiens gene GAPDH

Product Data

• Locus ID: 2597
• Forward Sequence: GTCTCCTCTGACTTCAACAGCG
• Reverse Sequence: ACCACCCTGTTGCTGTAGCCAA
• ACCN: NM_002046, NM_002046.1, NM_002046.2, NM_002046.3, NM_002046.4, NM_002046.5, BC009081, BC009081.1, BC001601, BC004109, BC013310, BC020308, BC023632, BC025925, BC026907, BC029340, BC029618, BC083511, BE893087, BG724119, BI463134, BM763361, BT006893, BU155402, NM_002046.7
• UniProt ID: P04406
• Synonyms: G3PD; GAPD; HEL-S-162eP
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient