GAPDH Human qPCR Primer Pair (NM_002046)
$150.00
In Stock*
Specifications
| Product Data | |
| Locus ID | 2597 |
|---|---|
| Forward Sequence | GTCTCCTCTGACTTCAACAGCG |
| Reverse Sequence | ACCACCCTGTTGCTGTAGCCAA |
| ACCN | NM_002046, NM_002046.1, NM_002046.2, NM_002046.3, NM_002046.4, NM_002046.5, BC009081, BC009081.1, BC001601, BC004109, BC013310, BC020308, BC023632, BC025925, BC026907, BC029340, BC029618, BC083511, BE893087, BG724119, BI463134, BM763361, BT006893, BU155402, NM_002046.7 |
| UniProt ID | P04406 |
| Synonyms | G3PD; GAPD; HEL-S-162eP |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Reviews
Documents
| Product Manuals |
| FAQs |
Resources
Citations
Promotion of Tumor Cell Senescence by the Antibody–Drug Conjugate, Sacituzumab Govitecan
Chakraborty, Sinanian, Rahman et al
Molecular Pharmacology (2026)
Chakraborty, Sinanian, Rahman et al
Molecular Pharmacology (2026)
AI Summary: OriGene contributed qSTAR qPCR primers for IL-6 (HP200567), IL-8 (CXCL8, HP200551), IL-1β (HP200544), and GAPDH (HP205798), which were used to measure gene expression levels in this study.
Snippet: triplicates using Power Track SYBR Green Mastermix (Applied Biosystems;Waltham, MA, USA, A46109) on the QuantStudio 3 Real-Time PCR System. qSTAR qPCR primers were purchased from OriGene (Rockville, MD, USA): IL-6: HP200567;IL-8 (CXCL8): HP200551;IL-1β: HP200544;GAPDH: HP205798. Relative mRNA expression was determined using the ΔΔCt method
Neural cell state modulation by PARK2 and dopaminergic neuroprotection by small molecule Parkin agonism
Gong, Bayati, Alban et al
bioRxiv (2026)
Gong, Bayati, Alban et al
bioRxiv (2026)
AI Summary: OriGene products contributed to this study by providing specific qPCR primers for ATF-3 (HP233668), ATF-4, GAPDH (HP205798), and Parkin (HP207857), which were used to assess gene expression changes relevant to neuronal differentiation and Parkin pathway activity.
Snippet: °C 1 min, with a melt curve. Relative expression was calculated by 2^–ΔΔCT using housekeeping genes as controls.Forward and Reverse Primers for ATF-3 and ATF-4 were obtained from Origene (HP233668 and;- GADPH primers (Origene, HP205798) had the following sequence for forward and Parkin primers (Origene, HP207857) had the following sequence for forward and
Globo H ceramide confers chemoresistance and poor prognosis to advanced gallbladder cancer via A2AR/cAMP/PKA pathway
Hung, Hung, Huang et al
Theranostics (2026) 16 (9), 4940-4958 DOI: 10.7150/thno.126092
Hung, Hung, Huang et al
Theranostics (2026) 16 (9), 4940-4958 DOI: 10.7150/thno.126092
Cited by 2
AI Summary: OriGene products, specifically the human ABCG2 (HP206658) and GAPDH (HP205798) qPCR primers, were used to measure gene expression levels in this study investigating chemoresistance mechanisms in gallbladder cancer.
Snippet: ef="HP206658">HP206658) and GAPDH (HP205798) were purchased from OriGene (Rockville, MD, USA). All PCR reactions were conducted on an Applied Biosystems 7500 Fast Real-Time PCR System with the following reaction conditions: pre-incubation at 95 °C for 10 s to acti
MiR-210-5p inhibits the proliferation and migration of colorectal cancer cells by down-regulating aquaporin 1
Kong, Zhao, Chen et al
J Physiol Pharmacol (2026) 77 (1), 127-138 DOI: 10.26402/jpp.2026.1.10
Kong, Zhao, Chen et al
J Physiol Pharmacol (2026) 77 (1), 127-138 DOI: 10.26402/jpp.2026.1.10
Capturing the Dynamic Placental Proteome and Galectin-3 Interactome Using Proximity Labeling
Reeves
Thesis (2026)
Reeves
Thesis (2026)
AI Summary: OriGene's HP205798 SYN1 product was used in the study to facilitate gene-specific experiments, contributing to the investigation of the placental proteome and Galectin-3 interactome.
Snippet: CCACCCTGTTGCTGTAGCCAA Origene HP205798 SYN1 CCCTCCATGCCGCTGTAT CGCTGCATTCTCCATAGAAACTC
Targeting TNFAIP2 with NIR-II CRISPR-Cas9 nanosystem to overcome cisplatin resistance in laryngeal cancer
Li, Wang, Guo et al
NPJ Precis Oncol (2025) 9 (1), 263 DOI: 10.1038/s41698-025-01054-w
Li, Wang, Guo et al
NPJ Precis Oncol (2025) 9 (1), 263 DOI: 10.1038/s41698-025-01054-w
Cited by 2
AI Summary: OriGene’s Human TNFAIP2 qPCR Primer Pair (HP209262) and Human GAPDH qPCR Primer Pair (HP205798) were used to measure gene expression levels, helping to assess the impact of TNFAIP2 knockout on cisplatin resistance in laryngeal cancer cells.
Snippet: ). GAPDH served as the internal control. Relative gene expression was calculated using the 2-ΔΔCT method. The primer pairs used in this study included the Human TNFAIP2 qPCR Primer Pair (HP209262, Origene, USA) and the Human GAPDH qPCR Primer Pair (HP205798, Origene, USA). The sequences of these primers are detailed in Table S1. Western blot analysis Cells from each experimental group were harv
Showing 1-6 of 36 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
