GAPDH (NM_002046) Human Untagged Clone
$457.00
In Stock*
Specifications
| Product Data | |
| Type | Human Untagged Clone |
|---|---|
| Target Symbol | GAPDH |
| Synonyms | G3PD; GAPD; HEL-S-162eP |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data | |
| Restriction Sites | NotI-NotI | |
| ACCN | NM_002046 |
| Insert Size | 1008 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_002046.2, NP_002037.2 |
| RefSeq Size | 1283 bp |
| RefSeq ORF | 1008 bp |
| Locus ID | 2597 |
| UniProt ID | P04406, V9HVZ4 |
| Cytogenetics | 12p13.31 |
| Domains | gpdh |
| Protein Families | ES Cell Differentiation/IPS |
| Protein Pathways | Alzheimer's disease, Glycolysis / Gluconeogenesis, Metabolic pathways |
| Summary | This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The encoded protein has additionally been identified to have uracil DNA glycosylase activity in the nucleus. Also, this protein contains a peptide that has antimicrobial activity against E. coli, P. aeruginosa, and C. albicans. Studies of a similar protein in mouse have assigned a variety of additional functions including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Many pseudogenes similar to this locus are present in the human genome. Alternative splicing results in multiple transcript variants. provided by RefSeq, Nov 2014 Transcript Variant: This variant (1) encodes the longest isoform (1). |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_002046" in other vectors (6)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| RC202309 | GAPDH (Myc-DDK-tagged)-Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | 10 ug |
$686.00
|
|
| RC202309L1 | Lenti ORF clone of Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Myc-DDK-tagged | 10 ug |
$986.00
|
|
| RC202309L2 | Lenti ORF clone of Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mGFP tagged | 10 ug |
$986.00
|
|
| RC202309L3 | Lenti ORF clone of Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Myc-DDK-tagged | 10 ug |
$986.00
|
|
| RC202309L4 | Lenti ORF clone of Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mGFP tagged | 10 ug |
$986.00
|
|
| RG202309 | GAPDH (tGFP-tagged) - Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | 10 ug |
$489.00
$886.00
|
|
Citations
Characterization of the Cardiac Overexpression of HSPB2 Reveals Mitochondrial and Myogenic Roles Supported by a Cardiac HspB2 Interactome
Grose, Langston, Wang et al
PLoS ONE (2015) 10 (10), e0133994 DOI: 10.1371/journal.pone.0133994
Grose, Langston, Wang et al
PLoS ONE (2015) 10 (10), e0133994 DOI: 10.1371/journal.pone.0133994
Cited by 13
AI Summary: OriGene’s GAPDH plasmid (catalog number SC118869) was used as a template to amplify GAPDH for cloning and functional studies in this paper.
Snippet: GAPDH was amplified from Origene plasmids SC118869 (accession number NM_002046) using the following primers, GGCCATATGGGGAAGGTGAAGGTCGGAGTC and GGCGGATCCTTACTCCTTGGAGGCCATGTGGGC, and cloned into pet15b at the NdeI/BamHI ... Cite SaveSaving
Human and pneumococcal cell surface glyceraldehyde-3-phosphate dehydrogenase (GAPDH) proteins are both ligands of human C1q protein
Terrasse, Tacnet-Delorme, Moriscot et al
J. Biol. Chem. (2012) 287 (51), 42620-33 DOI: 10.1074/jbc.M112.423731
Terrasse, Tacnet-Delorme, Moriscot et al
J. Biol. Chem. (2012) 287 (51), 42620-33 DOI: 10.1074/jbc.M112.423731
Cited by 3
AI Summary: OriGene’s human cDNA clone for GAPDH (NCBI Reference Sequence NM_002046) was used as the template to amplify the human GAPDH gene, enabling the study of its interaction with C1q in this research.
Snippet: during PCR. The human GAPDH gene was amplified from cDNA (GAPDH, NCBI Reference Sequence NM_002046, human cDNA clone, Origene), and a tobacco etch virus cleavage site was introduced at the 5′-extremity. The
Expression of organic anion transporter 2 in the human kidney and its potential role in the tubular secretion of guanine-containing antiviral drugs
Cheng, Vapurcuyan, Shahidullah et al
Drug Metab. Dispos. (2012) 40 (3), 617-24 DOI: 10.1124/dmd.111.042036
Cheng, Vapurcuyan, Shahidullah et al
Drug Metab. Dispos. (2012) 40 (3), 617-24 DOI: 10.1124/dmd.111.042036
Cited by 85
AI Summary: OriGene’s GAPDH cDNA plasmid was used as a standard control for absolute quantification of gene expression in this study.
Snippet: For absolute quantification, standard curves were generated for each transporter (OAT1, OAT2, OAT3, and OCT2) using the plasmids containing the respective transporter cDNAs. The plasmid containing the cDNA for GAPDH was obtained from OriGene (Rockville, MD).
Non-productive HIV-1 infection of human glomerular and urinary podocytes
Khatua, Taylor, Hildreth et al
Virology (2010) 408 (1), 119-27 DOI: 10.1016/j.virol.2010.09.005
Khatua, Taylor, Hildreth et al
Virology (2010) 408 (1), 119-27 DOI: 10.1016/j.virol.2010.09.005
Cited by 31
AI Summary: In this paper, OriGene products—specifically, the CD4 (Cat# RC211447) and CXCR4 (Cat# RC210468) expression plasmids—were used to transfect podocytes and demonstrate that expression of these HIV-1 entry receptors enables productive HIV-1 infection, highlighting the critical role of receptor presence in viral replication within podocytes.
Inhibition of encephalomyocarditis virus and poliovirus replication by quinacrine: implications for the design and discovery of novel antiviral drugs
Gasparian, Neznanov, Jha et al
J Virol (2010) 84 (18), 9390-7 DOI: 10.1128/JVI.02569-09
Gasparian, Neznanov, Jha et al
J Virol (2010) 84 (18), 9390-7 DOI: 10.1128/JVI.02569-09
AI Summary: OriGene products contributed to this paper by providing the pCMV6-XL4-p53 plasmid, which was used to study the effects of quinacrine on p53 IRES-mediated translation.
Inhibition of EMCV and poliovirus replication by quinacrine: implications for the design and discovery of novel anti-viral drugs
Gasparian, Neznanov, Jha et al
J. Virol (2010)
Gasparian, Neznanov, Jha et al
J. Virol (2010)
Showing 1-6 of 9 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
