OriGene Logo

Gapdh Mouse qPCR Primer Pair (NM_008084)

Be the first to review this product
SKU
MP205604
qSTAR qPCR primer pairs against Mus musculus gene Gapdh
  $150.00
2 Weeks*

Frequently Bought Together (4)

TA356083 Gapdh Antibody - C-terminal region
100 ul
$585.00
NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
MR204934 Gapdh (Myc-DDK-tagged) - Mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh)
10 ug
$289.00 $300.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "Gapdh or BC083065, BC083079, BC083080, BC083149, BC085274, BC085275, BC085315, BC091768, BC092252, BC092264, BC092267, BC092294, BC093508, BC094037, BC095932, BC096042, BC096440, BC096590, BC110311, NM_008084, NM_008084.1, NM_008084.2, NM_008084.3, BC091768.1, BC096042.1, BC020407, BC023196, BC091736, BC145810, BC145812, BI851476, BU504528"

Specifications
Specifications
Product Data
Locus ID 14433
Forward Sequence CATCACTGCCACCCAGAAGACTG
Reverse Sequence ATGCCAGTGAGCTTCCCGTTCAG
ACCN BC083065, BC083079, BC083080, BC083149, BC085274, BC085275, BC085315, BC091768, BC092252, BC092264, BC092267, BC092294, BC093508, BC094037, BC095932, BC096042, BC096440, BC096590, BC110311, NM_008084, NM_008084.1, NM_008084.2, NM_008084.3, BC091768.1, BC096042.1, BC020407, BC023196, BC091736, BC145810, BC145812, BI851476, BU504528
UniProt ID P16858
Synonyms Ga; Gapd
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.