OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Gapdh Mouse qPCR Primer Pair (NM_008084)

Be the first to review this product
SKU
MP205604
qSTAR qPCR primer pairs against Mus musculus gene Gapdh
  $150.00
2 Weeks*

Frequently Bought Together (4)

TA356083 Gapdh Antibody - C-terminal region
100 ul
$585.00
NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
MR204934 Gapdh (Myc-DDK-tagged) - Mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh)
10 ug
$289.00 $300.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "Gapdh or BC083065"

Specifications
Specifications
Product Data
Locus ID 14433
Forward Sequence CATCACTGCCACCCAGAAGACTG
Reverse Sequence ATGCCAGTGAGCTTCCCGTTCAG
ACCN BC083065, BC083079, BC083080, BC083149, BC085274, BC085275, BC085315, BC091768, BC092252, BC092264, BC092267, BC092294, BC093508, BC094037, BC095932, BC096042, BC096440, BC096590, BC110311, NM_008084, NM_008084.1, NM_008084.2, NM_008084.3, BC091768.1, BC096042.1, BC020407, BC023196, BC091736, BC145810, BC145812, BI851476, BU504528
UniProt ID P16858
Synonyms Ga; Gapd
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Driving tumor-associated macrophages to a CXCL9Hi/SPP1Low phenotype eliminates pancreatic cancer
Nguyen, Pfefferlé, Oh et al
Cell Rep Med (2026)
AI Summary: OriGene products contributed to this study by providing mouse-specific qPCR primers for SPP1 (cat# MP215080), CXCL9 (cat# MP202421), and GAPDH (cat# MP205604), which were used to measure gene expression changes in tumor-associated myeloid cells.
Snippet: An overnight treatment was applied on day 6. RNA was extracted on day 7 using RNeasy kit from Qiagen. qPCR assay was performed using mouse-specific primers designed by Origene (SPP1_cat# MP215080, CXCL9_cat# MP202421, and GAPDH_cat# MP205604)
Ameliorative effect of Rhus verniciflua Stokes on high-fat diet-induced obesity and advanced analysis with machine learning and deep learning-based network pharmacology
Lee, Lee, Kim et al
Life Sci (2026) 393, 124337 DOI: 10.1016/j.lfs.2026.124337
Cited by 1
AI Summary: OriGene contributed pre-validated mouse qPCR primer pairs (qSTAR), specifically Gapdh (MP205604), Actb (MP200232), Prkaa1 (MP211951), and Acaca (MP200195), which were used to assess gene expression changes in the study.
Snippet: All qPCR primers were purchased as pre-validated mouse primer pairs from OriGene (qSTAR), including Gapdh (MP205604), Actb (MP200232), Prkaa1 (MP211951), Acaca (MP200195)
A ligand-mimetic anti-TREM2 agonist antibody elevates soluble TREM2 and ameliorates pathology in mouse models of Alzheimer's disease and multiple sclerosis
Chen, Lu, Huang et al
J Neuroinflammation (2026)
Cited by 4
AI Summary: OriGene’s Mouse qPCR Primer Pairs for GAPDH (#MP205604) and Trem2 (#MP217538) were used in this study to quantify gene expression levels by real-time PCR, supporting the evaluation of TREM2 signaling and related effects in mouse models.
Snippet: Real-time PCR was performed on BIO-RAD CFX Connect 893 TM Real-Time System using 894 SsoAdvanced Universal SYBR Green Supermix (BIO-RAD, #1725270) with Mouse 895 qPCR Primer Pairs: GAPDH (OriGene, #MP205604), Trem2 (OriGene, #MP217538)
Oral and Intranasal Administration of Polydeoxyribonucleotide Isolated from Porphyra sp. Ameliorates Acute Lung Injury via Suppressing Proinflammatory Cytokine Production in Mice
Lee, Lee, Han et al
Curr Issues Mol Biol (2026) 48 (2) DOI: 10.3390/cimb48020187
Cited by 2
AI Summary: OriGene contributed to this study by supplying all the primers used for gene expression analysis, which were essential for measuring inflammatory cytokine and chemokine levels.
Snippet: ns:xlink="http://www.w3.org/1999/xlink" ext-link-type="pmc:entrez-nucleotide" xlink:href="MP205604">MP205604All primers were obtained from OriGene Technologies, Inc. (Rockville, MD, USA). F, forward primer;R, reverse primer
FigureFigureFigure
Reduced NF-κB/NLRP3/IL-18 signaling increases the protective effect of L-glutamine against LPS-induced retinal inflammation in mice: Utilization of network pharmacology and experimental validation
El Tabaa, El Tabaa, Mohsen et al
Eur J Pharmacol (2025) 1002, 177840 DOI: 10.1016/j.ejphar.2025.177840
Cited by 8
AI Summary: OriGene products, specifically antibodies against PPARγ (MP210761), xanthine oxidase (XO; MP218591), and GAPDH (MP205604), were used to assess protein expression levels in this study investigating the protective effects of L-glutamine on LPS-induced retinal inflammation.
Snippet: or activated receptor gamma (PPARγ;MP210761), xanthine oxidase (XO;MP218591), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH;MP205604) were from OriGene Technologies, Inc., in USA. …
Evaluation of platinum drug toxicity resulting from polyamine catabolism
Zahedi, Barone, Soleimani
Methods in Enzymology (2025)
AI Summary: OriGene products contributed to this study by providing specific qRT-PCR oligonucleotide pairs (Sat1-MP216112, Smox-MP216116, Odc1-MP210450, Gapdh-MP205604) used to measure gene expression related to polyamine catabolism and platinum drug toxicity.
Snippet: Master Mix (4385612, Applied Biosystems, Foster City, CA). 9. Appropriate qrt-PCR oligonucleotide pairs (Sat1-MP216112, Smox-MP216116, Odc1-MP210450, Gapdh-MP205604;OriGene, Rockville, MD). 10. Quantstudio 5 Real-Time PCR instrument (Applied Biosystems, East Lyme, CT) 11. RNA Master Mix: 6 ml 10 × RNA gel buffer (see below), 10 ml formaldehy
Showing 1-6 of 32 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products