OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TissueScan, Bladder Cancer cDNA Array I

Be the first to review this product
SKU
BLRT301
TissueScan Bladder Cancer Tissue qPCR Panel I (5) containing five identical sets of 24 tissues covering four disease stages and normal tissues
  $1,240.00
In Stock*

Frequently Bought Together (4)

D11-18 Polink-1 HRP Polymer Detection for MOUSE and RABBIT antibodies on human tissue
18 ml
$420.00
D12-6 Polink-1 HRP Polymer Detection for MOUSE antibody on human or animal tissue (non-rodent)
6 ml
$250.00
HP205798 qSTAR qPCR primer pairs against Homo sapiens gene GAPDH 200 reactions
$150.00
MP205604 qSTAR qPCR primer pairs against Mus musculus gene Gapdh 200 reactions
$150.00
Specifications
Specifications
Product Data
TissueScan Type Cancer Specific
Array Name Bladder Cancer cDNA Array I
Clinical Info
Diagnosis Category Bladder Cancer
Tissue Bladder
Shipping Ambient
Description TissueScan Bladder Cancer Tissue qPCR Panel I (5) containing five identical sets of 24 tissues covering four disease stages and normal tissues
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

SETD6 regulates NF-κB signaling in urothelial cell survival: Implications for bladder cancer
Mukherjee, Cardenas, Bedolla et al
Oncotarget (2017) 8 (9), 15114-15125 DOI: 10.18632/oncotarget.14750
Snippet: cDNA array (Origene, TissueScan Cancer and Normal Tissue cDNA Arrays) was used to determine the level of SETD6 expression in different bladder tissue samples (n = 24). SETD6 primer (Integrated DNA Technologies, SETD6: forward- AGCTTTCAGGAACCACTGGAGGAA, reverse- ATGGCCTTTAGGAATGGGCTGAGT) was mixed with PCR master mix, equal volumes were added to each well of the same plate and subjected to real-ti...
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products