OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SOX4 Human shRNA Plasmid Kit (Locus ID 6659)

Be the first to review this product
SKU
TG315513
SOX4 - Human, 4 unique 29mer shRNA constructs in retroviral GFP vector, 5µg of each construct provided
  $883.00
2 Weeks*

Frequently Bought Together (2)

TA324704 SOX4 Antibody (N-term)
400 ul
$645.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SOX4 or NM_003107"

Specifications
Specifications
Product Data
Locus ID 6659
Synonyms CSS10; EVI16
Vector pGFP-V-RS
E. coli Selection Kanamycin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components SOX4 - Human, 4 unique 29mer shRNA constructs in retroviral GFP vector(Gene ID = 6659). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-V-RS Vector, TR30013, included for free.
RefSeq NM_003107, NM_003107.1, NM_003107.2, BC072668, BC072668.1, BM459088, BM817788, BM822945, NM_003107.3
UniProt ID Q06945
Summary This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins, such as syndecan binding protein (syntenin). The protein may function in the apoptosis pathway leading to cell death as well as to tumorigenesis and may mediate downstream effects of parathyroid hormone (PTH) and PTH-related protein (PTHrP) in bone development. The solution structure has been resolved for the HMG-box of a similar mouse protein. provided by RefSeq, Jul 2008
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Down-regulated SOX4 expression suppresses cell proliferation, metastasis and induces apoptosis in Xuanwei female lung cancer patients
Zhou, Wang, Huang et al
J. Cell. Biochem. (2015)
Cited by 37
AI Summary: OriGene's pGFP-V-RS retroviral vector was used to deliver SOX4-targeting shRNA into lung cancer cells, enabling the authors to investigate the effects of SOX4 knockdown on cell proliferation, metastasis, and apoptosis.
Snippet: Cell transfection SOX4 small hairpin RNA (shRNA) was designed and cloned into the pGFP-V-RS retroviral vector (Origene, Maryland, USA). The pGFP-V-RS-SOX4 shRNA sequence was AGCAAACCGCACGCCAAGCTCATCCTGGC, and the negative control shRNA ... Related articles All 3 versions Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products