OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

HBS1L (NM_006620) Human Over-expression Lysate

Be the first to review this product
SKU
LY416509
Transient overexpression lysate of HBS1-like (S. cerevisiae) (HBS1L), transcript variant 1 (as WB positive control)
  $436.00
In Stock*
Bulk/Customize

Frequently Bought Together (3)

TA800554 HBS1L mouse monoclonal antibody, clone OTI1C1 (formerly 1C1) 100 ul
$447.00
TA811000S beta Actin Mouse Monoclonal Antibody, Clone OTI1, Loading Control 30 ul
$200.00
TA592569 DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
100 ul
$519.00

Other products for "HBS1L or NM_006620"

Specifications
Specifications
Product Data
Species Human
Expression Host HEK293T
Expression cDNA Clone or AA Sequence TrueORF Clone RC208125
Tag C-Myc/DDK
Detection Antibodies Clone OTI4C5, Anti-DDK (FLAG) monoclonal antibody (TA50011-100)
ACCN NM_006620, NP_006611
Synonyms EF-1a; eRF3c; ERFS; HBS1; HSPC276
Predicted MW 75.5 kDa
Components 1 vial of 100 µg total protein derived from gene specific transient over-expression cell lysate in RIPA buffer
1 vial of 100 µg whole HEK293T cell lysate in RIPA buffer
Storage The lysate is shipped with dry ice. Upon receiving, store the sample at -80°C. Also after dilution, the protein sample should be aliquoted and stored at -80°C for long term storage. Avoid repeated freeze-thaw cycles. Lysate samples can be diluted with 1x SDS-PAGE running buffer (with reducing agent). Lysate samples are stable for 12 months from the date of receipt when stored at -80°C. Lysate samples are stable for 12 months from the date of receipt when stored at -80°C.
Shipping Dry Ice
Preparation HEK293T cells in 10-cm dishes were transiently transfected with MegaTran Transfection Reagent (TT200002) and 5ug TrueORF cDNA plasmid. Transfected cells were cultured for 48hrs before collection. The cells were lysed in modified RIPA buffer (25mM Tris-HCl pH7.6, 150mM NaCl, 1% NP-40, 1mM EDTA, 1xProteinase inhibitor cocktail mix (Sigma), 1mM PMSF and 1mM Na3VO4), and then centrifuged to clarify the lysate. Protein concentration was measured by BCA kit (Thermo Scientific Inc.).
Reference Data
RefSeq NP_006611
Locus ID 10767
Cytogenetics 6q23.3
Protein Families WB
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other "HBS1L" proteins (3)
SKU Description Size Price
LC416509 Lyophilized HBS1L HEK293T cell transient overexpression lysate (as WB positive control) 20 ug
$206.00
LC428733 Lyophilized HBS1L HEK293T cell transient overexpression lysate (as WB positive control) 20 ug
$206.00
LY428733 Transient overexpression lysate of HBS1-like (S. cerevisiae) (HBS1L), transcript variant 2 (as WB positive control) 100 ug
$436.00

file-alt Citations

mRNA levels can be reduced by antisense oligonucleotides via no-go decay pathway
Liang, Nichols, Hsu et al
Nucleic Acids Res. (2019) 47 (13), 6900-6916 DOI: 10.1093/nar/gkz500
AI Summary: OriGene’s human HBS1L cDNA clone (RC208125) was used as a template to amplify and study HBS1L, enabling the investigation of its role in the no-go decay pathway activated by antisense oligonucleotides.
Snippet: purification were performed essentially as described (61). Briefly, full-length human HBS1L (NM 006620) was amplified by PCR from the cDNA clone (Origene RC208125). The forward PCR primer (5 -gctagc AGCCACCATGGCCCGGCATCGGAATG
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products