OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ALDH1A1 (NM_000689) Human Over-expression Lysate

Be the first to review this product
SKU
LY400230
Transient overexpression lysate of aldehyde dehydrogenase 1 family, member A1 (ALDH1A1) (as WB positive control)
  $436.00
In Stock*
Bulk/Customize

Frequently Bought Together (3)

TA302024 ALDH1A1 Antibody (Center)
400 ul
$645.00
TA811000S beta Actin Mouse Monoclonal Antibody, Clone OTI1, Loading Control 30 ul
$200.00
TA592569 DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
100 ul
$519.00

Other products for "ALDH1A1 or NM_000689"

Specifications
Specifications
Product Data
Species Human
Expression Host HEK293T
Expression cDNA Clone or AA Sequence TrueORF Clone RC200723
Tag C-Myc/DDK
Detection Antibodies Clone OTI4C5, Anti-DDK (FLAG) monoclonal antibody (TA50011-100)
ACCN NM_000689, NP_000680
Synonyms ALDC; ALDH-E1; ALDH1; ALDH11; HEL-9; HEL-S-53e; HEL12; PUMB1; RALDH1
Predicted MW 54.7 kDa
Components 1 vial of 100 µg total protein derived from gene specific transient over-expression cell lysate in RIPA buffer
1 vial of 100 µg whole HEK293T cell lysate in RIPA buffer
Storage The lysate is shipped with dry ice. Upon receiving, store the sample at -80°C. Also after dilution, the protein sample should be aliquoted and stored at -80°C for long term storage. Avoid repeated freeze-thaw cycles. Lysate samples can be diluted with 1x SDS-PAGE running buffer (with reducing agent). Lysate samples are stable for 12 months from the date of receipt when stored at -80°C. Lysate samples are stable for 12 months from the date of receipt when stored at -80°C.
Shipping Dry Ice
Preparation HEK293T cells in 10-cm dishes were transiently transfected with MegaTran Transfection Reagent (TT200002) and 5ug TrueORF cDNA plasmid. Transfected cells were cultured for 48hrs before collection. The cells were lysed in modified RIPA buffer (25mM Tris-HCl pH7.6, 150mM NaCl, 1% NP-40, 1mM EDTA, 1xProteinase inhibitor cocktail mix (Sigma), 1mM PMSF and 1mM Na3VO4), and then centrifuged to clarify the lysate. Protein concentration was measured by BCA kit (Thermo Scientific Inc.).
Reference Data
RefSeq NP_000680
Locus ID 216
Cytogenetics 9q21.13
Protein Families WB
Protein Pathways Metabolic pathways, Retinol metabolism
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other "ALDH1A1" proteins (4)
SKU Description Size Price
PH300723 ALDH1A1 MS Standard C13 and N15-labeled recombinant protein (NP_000680) 10 ug
$3,360.00
LC400230 Lyophilized ALDH1A1 HEK293T cell transient overexpression lysate (as WB positive control) 20 ug
$206.00
TP300723 Recombinant protein of human aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), 20 µg 20 ug
$867.00
TP720901 Purified recombinant protein of Human aldehyde dehydrogenase 1 family, member A1 (ALDH1A1) 10 ug
$260.00

file-alt Citations

Effect of ALDH1A1 Gene Knockout on Drug Resistance in Paclitaxel and Topotecan Resistant Human Ovarian Cancer Cell Lines in 2D and 3D Model
Nowacka, Ginter-Matuszewska, Świerczewska et al
Int J Mol Sci (2022) 23 (6) DOI: 10.3390/ijms23063036
Cited by 28
AI Summary: OriGene’s HDR (Homology Directed Repair) mediated CRISPR/Cas9 knockout kit (catalog No. KN200723) was used to perform ALDH1A1 gene editing in ovarian cancer cell lines, enabling the study of ALDH1A1’s role in drug resistance.
Snippet: The ALDH1A1 gene editing was performed in W1PR1 and W1TR cells using CRISPR-Cas9 gene-editing technology. … KN200723). The CRISPR/Cas9 knockout system used in this study consists of 3 plasmids: ALDH1A1 gRNA vector 1 Target Sequence: GAATCTTCAAATCGGTGAGT;- The HDR (Homology Directed Repair) mediated CRISPR/Cas9 knockout kit was used in this study (OriGene Technologies, Rockville, MD, USA, catalog No. KN200723). …
FigureFigureFigure
WB IF
Stemness marker ALDH1A1 promotes tumor angiogenesis via retinoic acid/HIF-1α/VEGF signalling in MCF-7 breast cancer cells
Ciccone, Terzuoli, Donnini et al
J. Exp. Clin. Cancer Res. (2018) 37 (1), 311 DOI: 10.1186/s13046-018-0975-0
AI Summary: OriGene contributed lentiviral particles to this study, which were used to manipulate ALDH1A1 expression levels in MCF-7 breast cancer cells to investigate its role in tumor angiogenesis.
Snippet: Louis, MO, USA). CelLytic MT Cell Lysis Reagent, Fluoromount Aqueous Mounting Medium, 3 kDa FITC-Dextran were from Life Technologies (Carlsbad, CA, USA). Lentiviral particles were from OriGene (Rockville, MD, USA) Cached;CelLytic MT Cell Lysis Reagent, Fluoromount Aqueous Mounting Medium, 3 kDa FITC-Dextran were from Life Technologies (Carlsbad, CA, USA). Lentiviral particles were from Or...
FigureFigureFigure
ALDH1A1 and HLTF modulate the activity of lysosomal autophagy inhibitors in cancer cells
Piao, Ojha, Rebecca et al
Autophagy (2017)
AI Summary: OriGene products pCMV6 empty vector (PS100001) and pCMV6 HLTF (RC207920) were used for transfecting HT29 cells to study the role of HLTF in modulating cancer cell responses to lysosomal autophagy inhibitors.
Snippet: For detection of RAD52 foci, HT29 cells were transfected with pCMV6 empty vector (Origene, PS100001) and pCMV6 HLTF (Origene, RC207920) and then the indicated cells were grown on chamber slides overnight to reach 50% con fl uence
Aldehyde dehydrogenase 1A1--a new mediator of resistance to temozolomide in glioblastoma
Schäfer, Teufel, Ringel et al
Neuro Oncol (2012) 14 (12), 1452-64 DOI: 10.1093/neuonc/nos270
Cited by 102
AI Summary: In this study, OriGene products including ALDH1A1 shRNA (OriGene) were used to knock down ALDH1A1 expression in glioblastoma cell lines, helping to demonstrate that reducing ALDH1A1 levels sensitizes cells to temozolomide and implicates ALDH1A1 as a mediator of drug resistance.
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products