OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Stat3 Mouse qPCR Primer Pair (NM_213659)

Be the first to review this product
SKU
MP215436
qSTAR qPCR primer pairs against Mus musculus gene Stat3
  $150.00
3 Days*

Frequently Bought Together (3)

NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
MR227265 Stat3 (Myc-DDK-tagged) - Mouse signal transducer and activator of transcription 3 (Stat3), transcript variant 1
10 ug
$1,057.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "Stat3 or BC003806"

Specifications
Specifications
Product Data
Locus ID 20848
Forward Sequence AGGAGTCTAACAACGGCAGCCT
Reverse Sequence GTGGTACACCTCAGTCTCGAAG
ACCN BC003806, BC019168, NM_213659, NM_213659.1, NM_213659.2, NM_213659.3, BC037688, BY301717
UniProt ID P42227
Synonyms 1110034C02Rik; A; Aprf; AW109958
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

IFN-γ-mediated inhibition of lung cancer correlates with PD-L1 expression and is regulated by PI3K-AKT signaling
Gao, Yang, Cai et al
Int. J. Cancer (2018)
AI Summary: OriGene Technologies contributed to this study by providing the gene-specific primers used for PCR analysis, as mentioned in the methods section.
Snippet: Fast SYBR Green Master Mix was obtained from Applied Biosystems. The primers were obtained from OriGene Technologies (Rockville, MD) and the sequences for primers were shown in Supplementary Table 2. Transfections
Integrin-FAK signaling rapidly and potently promotes mitochondrial function through STAT3
Visavadiya, Keasey, Razskazovskiy et al
Cell Commun. Signal (2016) 14 (1), 32 DOI: 10.1186/s12964-016-0157-7
AI Summary: OriGene’s CRISPR-Cas9 pre-cloned guide RNA cassettes targeting mouse STAT3 (Cat# KN316845) were used to knock down STAT3 expression, enabling the study of its role in integrin-FAK-STAT3 signaling and mitochondrial function.
Snippet: CRISPR-Cas9 pre-cloned guide RNA cassettes targeting mouse STAT3 were purchased from Origene (Cat# KN316845) and knockdown performed according to [44] with some alterations
FigureFigureFigure
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products