OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Stat1 Mouse qPCR Primer Pair (NM_009283)

Be the first to review this product
SKU
MP215434
qSTAR qPCR primer pairs against Mus musculus gene Stat1
  $150.00
3 Days*

Frequently Bought Together (4)

TA319404 Anti-STAT1 pY701 (RABBIT) Antibody, 100 ug
100 ug
$870.00
NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
MR227437 Stat1 (Myc-DDK-tagged) - Mouse signal transducer and activator of transcription 1 (Stat1), transcript variant 2
10 ug
$589.00 $1,029.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "Stat1 or BC004808"

Specifications
Specifications
Product Data
Locus ID 20846
Forward Sequence GCCTCTCATTGTCACCGAAGAAC
Reverse Sequence TGGCTGACGTTGGAGATCACCA
ACCN BC004808, NM_009283, NM_009283.1, NM_009283.2, NM_009283.3, NM_009283.4, BC042551, BC057690, BX513160
Synonyms 2010005J02Rik; AA408197
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Multifunctional oncolytic nanoparticles deliver self-replicating IL-12 RNA to eliminate established tumors and prime systemic immunity
Li, Su, Zhao et al
Nat Cancer (2020)
Cited by 238
AI Summary: OriGene contributed specific qPCR primer sets for Stat1 (MP215434), Stat2 (MP215434), IRF9 (MP206708), IRF3 (MP206702), and cGAS (MP214711), which were used to measure gene expression changes in cells treated with oncolytic nanoparticles in this study.
Snippet: …N8080234), followed by amplification with Sybr Green Master Mix (Roche) and specific primers for Stat1 (cat. … MP215434), Stat2 (cat. … MP215434), IRF9 (cat. … MP206708), IRF3 (cat. … MP206702) and cGAS (cat. … MP214711), from Origene and detected by a Roche LightCycler 480. …
IFN-γ-mediated inhibition of lung cancer correlates with PD-L1 expression and is regulated by PI3K-AKT signaling
Gao, Yang, Cai et al
Int. J. Cancer (2018)
AI Summary: OriGene Technologies contributed to this study by providing the gene-specific primers used for PCR analysis, as mentioned in the methods section.
Snippet: Fast SYBR Green Master Mix was obtained from Applied Biosystems. The primers were obtained from OriGene Technologies (Rockville, MD) and the sequences for primers were shown in Supplementary Table 2. Transfections
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products