OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

C3 Mouse qPCR Primer Pair (NM_009778)

Be the first to review this product
SKU
MP202871
qSTAR qPCR primer pairs against Mus musculus gene C3
  $150.00
3 Days*

Frequently Bought Together (4)

TA374152 C3 Rabbit polyclonal Antibody
100 ul
$410.00
NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
MR226388 C3 (Myc-DDK-tagged) - Mouse complement component 3 (C3)
10 ug
$589.00 $1,422.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "C3 or BC043338"

Specifications
Specifications
Product Data
Locus ID 12266
Forward Sequence CGCAACGAACAGGTGGAGATCA
Reverse Sequence CTGGAAGTAGCGATTCTTGGCG
ACCN BC043338, NM_009778, NM_009778.1, NM_009778.2, NM_009778.3, BC029976, BY326535
UniProt ID P01027
Synonyms AI255234; ASP; HSE-MSF; Plp
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Duhuo Jisheng Decoction Mitigates Osteochondral Degeneration in Knee Osteoarthritis through Modulation of Complement C3a/C3AR1-IKKβ-NF-κB Signaling
Wang, Ruan, Bian et al
Journal of Pharmaceutical Analysis (2026)
AI Summary: OriGene contributed to the study by providing qPCR primers for the C3 gene (product: OriGene MP202871), which were used to measure gene expression levels in the investigation of Duhuo Jisheng Decoction’s effects on osteochondral degeneration.
Snippet: Quantitative PCR was performed using SYBR Green chemistry on a real-time PCR system under standard conditions. qPCR primers were purchased from OriGene (Rockville, MD, USA). Target genes were C3 and C3AR1;expression was normalized to Gapdh using the 2ˆ(-ΔΔCt) method. Primer sequences used (5′-3′): C3 (NM_009778;OriGene MP202871)
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products