OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Telomerase reverse transcriptase (TERT) Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN217436LP
TERT - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (3)

RC217436 TERT (Myc-DDK-tagged)-Human telomerase reverse transcriptase (TERT), transcript variant 1
10 ug
$589.00 $985.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "Telomerase reverse transcriptase or NM_001193376"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Vector Luciferase-Puro
Target Symbol Telomerase reverse transcriptase
Locus ID 7015
Components

KN217436G1, Telomerase reverse transcriptase gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCCACGTTCGTGCGGCGCC

KN217436G2, Telomerase reverse transcriptase gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ACCAGCGCGCGGAAAGCCGC

KN217436LPD, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001193376, NM_003219, NM_198253, NM_198254, NM_198255, NR_149162, NR_149163
UniProt ID O14746
Synonyms CMM9; DKCA2; DKCB4; EST2; hEST2; hTRT; PFBMFT1; TCS1; TP2; TRT
Summary Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. provided by RefSeq, Jul 2008
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA104825 TERT CRISPRa kit - CRISPR gene activation of human telomerase reverse transcriptase 1 kit
$1,657.00
KN217436 TERT - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217436BN TERT - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217436RB TERT - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN417436 TERT - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products