OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CA150 (TCERG1) Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN217192
TCERG1 - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA331184 Rabbit Polyclonal Anti-TCERG1 Antibody
100 ul
$585.00
RC218654 TCERG1 (Myc-DDK-tagged)-Human transcription elongation regulator 1 (TCERG1), transcript variant 2
10 ug
$589.00 $937.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "CA150 or NM_001040006"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol CA150
Locus ID 10915
Components

KN217192G1, CA150 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAGTGAACGATTCAACCCGG

KN217192G2, CA150 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCTCGTGAGCAGAGATGTGA

KN217192D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001040006, NM_006706
UniProt ID O14776
Synonyms CA150; TAF2S; Urn1
Summary This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. provided by RefSeq, Jul 2008
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA107484 TCERG1 CRISPRa kit - CRISPR gene activation of human transcription elongation regulator 1 1 kit
$1,657.00
KN217192BN TCERG1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217192LP TCERG1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217192RB TCERG1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN417192 TCERG1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

Role for the splicing factor TCERG1 in Cajal body integrity and snRNP assembly
Moreno-Castro, Prieto-Sánchez, Sánchez-Hernández et al
J. Cell. Sci. (2019)
AI Summary: OriGene’s TCERG1 human gene knockdown kit was used to generate HEK293T cell lines with reduced TCERG1 expression, enabling the study of TCERG1’s role in Cajal body integrity and snRNP assembly.
Snippet: previously (Munoz-Cobo et al., 2017). The scramble, 1AC4 and 2AC2 cell lines were obtained using a TCERG1 human gene knockdown kit in HEK293T cells according to the manufacturer's instructions (Origene, Rockville, MD, USA). Cells were cultured in
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products