OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Eph receptor B4 (EPHB4) Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN208559LP
EPHB4 - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA367458 EPHB4 rabbit polyclonal antibody
100 ul
$310.00
RC208559 EPHB4 (Myc-DDK-tagged)-Human EPH receptor B4 (EPHB4)
10 ug
$904.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "Eph receptor B4 or NM_004444"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Vector Luciferase-Puro
Target Symbol Eph receptor B4
Locus ID 2050
Components

KN208559G1, Eph receptor B4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCTTCGTTGGCCGCAGCTT

KN208559G2, Eph receptor B4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGGTGAGTTTCCTTGCGGGG

KN208559LPD, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_004444
UniProt ID P54760
Synonyms HTK; MYK1; TYRO11
Summary Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. provided by RefSeq, Jul 2008
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA101429 EPHB4 CRISPRa kit - CRISPR gene activation of human EPH receptor B4 1 kit
$1,657.00
KN208559 EPHB4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN208559BN EPHB4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN208559RB EPHB4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN408559 EPHB4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products