OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Junctional Adhesion Molecule 1 (F11R) Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN200004
F11R - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA506017 F11R mouse monoclonal antibody, clone OTI3H3 (formerly 3H3) 100 ul
$447.00
RC221478 F11R (Myc-DDK-tagged)-Human F11 receptor (F11R)
10 ug
$450.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "Junctional Adhesion Molecule 1 or NM_016946"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol Junctional Adhesion Molecule 1
Locus ID 50848
Components

KN200004G1, Junctional Adhesion Molecule 1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: ACCGATTCCTCCCGAAACTC

KN200004G2, Junctional Adhesion Molecule 1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGACAAAGGCGCAAGTCGAG

KN200004D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_016946, NM_144501, NM_144502, NM_144503, NM_144504, NM_001348091
UniProt ID Q9Y624
Synonyms CD321; JAM; JAM1; JAMA; JCAM; KAT; PAM-1
Summary Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. provided by RefSeq, Jul 2008
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA109467 F11R CRISPRa kit - CRISPR gene activation of human F11 receptor 1 kit
$1,657.00
KN200004BN F11R - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN200004LP F11R - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN200004RB F11R - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN400004 F11R - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products