OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Sox1ot activation kit by CRISPRa

Be the first to review this product
SKU
GA217630
Sox1ot CRISPRa kit - CRISPR gene activation of mouse Sox1 overlapping transcript
  $1,657.00
4 Weeks*

Other products for "Sox1ot"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Sox1ot
Locus ID 434280
Components

GA217630G1, Sox1ot gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTCGGGACCCTTGGACCAT

GA217630G2, Sox1ot gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGGCGCTTCATTATGTGG

GA217630G3, Sox1ot gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGACTCGCAAGACAATTTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001013812, NR_027975
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Loss of the lncRNA SOX1-OT promotes p53-dependent cell-cycle arrest in astrocytes
Fuchs, Schröder, Pena et al
bioRxiv (2026)
AI Summary: OriGene contributed to this study by providing a tGFP reporter gene (GA217630) and designing the gRNA for targeting Sox1ot, which were essential tools for investigating the role of SOX1-OT in astrocyte cell-cycle regulation.
Snippet: a tGFP reporter gene were obtained 1 from Origene (GA217630) (Origene, MD, USA). A The gRNA for targeting Sox1ot was designed by Origene 4 and had the following
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products