OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Sirpa activation kit by CRISPRa

Be the first to review this product
SKU
GA203483
Sirpa CRISPRa kit - CRISPR gene activation of mouse signal-regulatory protein alpha
  $1,657.00
4 Weeks*

Other products for "Sirpa"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Sirpa
Locus ID 19261
Components

GA203483G1, Sirpa gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGACTCACAGCAACGGAT

GA203483G2, Sirpa gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACACCGACCTGCCTGGGATT

GA203483G3, Sirpa gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTATGCTGCTCATCTGTTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001177646, NM_001177647, NM_001291019, NM_001291020, NM_001291021, NM_001291022, NM_007547, NM_001355158, NM_001355160
UniProt ID P97797
Synonyms AI835480; Bit; CD172a; P84; Ptpns1; SHP-1; SHPS-1; SIRP
Summary Immunoglobulin-like cell surface receptor for CD47. Acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. Supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. May play a key role in intracellular signaling during synaptogenesis and in synaptic function. Involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. Mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation. CD47 binding prevents maturation of immature dendritic cells and inhibits cytokine production by mature dendritic cells (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN515798 Sirpa - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products