Mouse H19 activation kit by CRISPRa
SKU
GA201799
H19 CRISPRa kit - CRISPR gene activation of mouse H19, imprinted maternally expressed transcript
$1,657.00
4 Weeks*
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
|---|---|
| Target Symbol | H19 |
| Locus ID | 14955 |
| Components |
GA201799G1, H19 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGCACCACCGTTCTATGA GA201799G2, H19 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGACATCAAGGGAGATATC GA201799G3, H19 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGTGCGCTGGAACGATACA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NR_001592, NR_130973, NR_130974 |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
