OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Gata3 activation kit by CRISPRa

Be the first to review this product
SKU
GA201553
Gata3 CRISPRa kit - CRISPR gene activation of mouse GATA binding protein 3
  $1,657.00
4 Weeks*

Other products for "Gata3"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Gata3
Locus ID 14462
Components

GA201553G1, Gata3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTAAAGGGGTGCTACTGCGC

GA201553G2, Gata3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGTCTTAACTGGAGGAAGT

GA201553G3, Gata3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACTTTTGGGAGCAATGACG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_008091, NM_001355110, NM_001355111, NM_001355112
UniProt ID P23772
Synonyms Gata-3; jal
Summary Transcriptional activator which binds to the enhancer of the T-cell receptor alpha and delta genes. Binds to the consensus sequence 5'-AGATAG-3'. Required for the T-helper 2 (Th2) differentiation process following immune and inflammatory responses.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN506323 Gata3 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products