OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Col6a3 activation kit by CRISPRa

Be the first to review this product
SKU
GA200823
Col6a3 CRISPRa kit - CRISPR gene activation of mouse collagen, type VI, alpha 3
  $1,657.00
4 Weeks*

Other products for "Col6a3"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Col6a3
Locus ID 12835
Components

GA200823G1, Col6a3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCCTTACAAGCATTTAGC

GA200823G2, Col6a3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAGCTGATGTCACCTATGA

GA200823G3, Col6a3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACAGTTTGGGTCTGTCCTA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001243008, NM_001243009, NM_009935
Synonyms AI507288; Col6a-3
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products