OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human RBM20 activation kit by CRISPRa

Be the first to review this product
SKU
GA116976
RBM20 CRISPRa kit - CRISPR gene activation of human RNA binding motif protein 20
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA389674 RBM20 Rabbit pAb
100 ul
$410.00
RC226364 RBM20 (Myc-DDK-tagged)-Human RNA binding motif protein 20 (RBM20)
10 ug
$1,602.00

Other products for "RBM20"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol RBM20
Locus ID 282996
Components

GA116976G1, RBM20 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAAGTAGTTGCTAGGTCTC

GA116976G2, RBM20 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTTTCCTCCCGCAACCACG

GA116976G3, RBM20 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCTTTTCTCTACTTCCCG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001134363
UniProt ID Q5T481
Summary This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. provided by RefSeq, Apr 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN426364 RBM20 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products