OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human Ikaros (IKZF1) activation kit by CRISPRa

Be the first to review this product
SKU
GA107033
IKZF1 CRISPRa kit - CRISPR gene activation of human IKAROS family zinc finger 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA329300 Rabbit Polyclonal anti-IKZF1 antibody
100 ul
$585.00
RC213207 IKZF1 (Myc-DDK-tagged)-Human IKAROS family zinc finger 1 (Ikaros) (IKZF1), transcript variant 1
10 ug
$725.00

Other products for "IKZF1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol IKZF1
Locus ID 10320
Components

GA107033G1, Ikaros gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGACTTGTAGGAGCCACC

GA107033G2, Ikaros gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCAAGCTGAACACATTGC

GA107033G3, Ikaros gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACGCAAAGAGCCGTCGAG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001220765, NM_001220766, NM_001220767, NM_001220768, NM_001220769, NM_001220770, NM_001220771, NM_001220772, NM_001220773, NM_001220774, NM_001220775, NM_001220776, NM_001291837, NM_001291838, NM_001291839, NM_001291840, NM_001291841, NM_001291842, NM_001291843, NM_001291844, NM_001291845, NM_001291846, NM_001291847, NM_006060
UniProt ID Q13422
Synonyms Hs.54452; IK1; IKAROS; LyF-1; LYF1; PPP1R92; PRO0758; ZNFN1A1
Summary This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). provided by RefSeq, May 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN413207 IKZF1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products