OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human GPRASP1 activation kit by CRISPRa

Be the first to review this product
SKU
GA106545
GPRASP1 CRISPRa kit - CRISPR gene activation of human G protein-coupled receptor associated sorting protein 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA349108 Rabbit Polyclonal Anti-GPRASP1 Antibody
100 ug
$640.00
RC216371 GPRASP1 (Myc-DDK-tagged)-Human G protein-coupled receptor associated sorting protein 1 (GPRASP1), transcript variant 1
10 ug
$589.00 $1,193.00

Other products for "GPRASP1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol GPRASP1
Locus ID 9737
Components

GA106545G1, GPRASP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACGCCTCTGCACCAAACT

GA106545G2, GPRASP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGATACGGCGCGAAAGTGC

GA106545G3, GPRASP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACCTCTGGGTCGGAACTA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001099410, NM_001099411, NM_001184727, NM_014710
UniProt ID Q5JY77
Synonyms GASP; GASP-1; GASP1
Summary This gene encodes a member of the GPRASP (G protein-coupled receptor associated sorting protein) family. The protein may modulate lysosomal sorting and functional down-regulation of a variety of G-protein coupled receptors. It targets receptors for degradation in lysosomes. The receptors interacting with this sorting protein include D2 dopamine receptor (DRD2), delta opioid receptor (OPRD1), beta-2 adrenergic receptor (ADRB2), D4 dopamine receptor (DRD4) and cannabinoid 1 receptor (CB1R). Multiple alternatively spliced transcript variants encoding the same protein have been identified. provided by RefSeq, May 2010
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN412262 GPRASP1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products