OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human GPR65 activation kit by CRISPRa

Be the first to review this product
SKU
GA105601
GPR65 CRISPRa kit - CRISPR gene activation of human G protein-coupled receptor 65
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA351235 Rabbit Polyclonal Anti-GPR65 Antibody
100 ul
$205.00
RC207600 GPR65 (Myc-DDK-tagged)-Human G protein-coupled receptor 65 (GPR65)
10 ug
$457.00

Other products for "GPR65"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol GPR65
Locus ID 8477
Components

GA105601G1, GPR65 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGGGAGATGTATACGAA

GA105601G2, GPR65 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGAGATGCTGCTTCCTCAT

GA105601G3, GPR65 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACATATATTCCATTAAGTAA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_003608
UniProt ID Q8IYL9
Synonyms hTDAG8; TDAG8
Summary Receptor for the glycosphingolipid psychosine (PSY) and several related glycosphingolipids (PubMed:11309421). Plays a role in immune response by maintaining lysosome function and supporting phagocytosis-mediated intracellular bacteria clearance (PubMed:27287411). May have a role in activation-induced cell death or differentiation of T-cells (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN407600 GPR65 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products