OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human KMT2D activation kit by CRISPRa

Be the first to review this product
SKU
GA105405
KMT2D CRISPRa kit - CRISPR gene activation of human lysine methyltransferase 2D
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA347233 Rabbit Polyclonal Mll4 Antibody
100 ul
$485.00
RC221064 MLL2 (Myc-DDK-tagged)-Human myeloid/lymphoid or mixed-lineage leukemia 2 (MLL2)
10 ug
$6,603.00

Other products for "KMT2D"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol KMT2D
Locus ID 8085
Components

GA105405G1, KMT2D gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTCTTCCATCCCCCTCCC

GA105405G2, KMT2D gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCGCCTCATTTACCGCCC

GA105405G3, KMT2D gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCCGCGAAACTAGGACTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_003482
UniProt ID O14686
Synonyms AAD10; ALR; CAGL114; KABUK1; KMS; MLL2; MLL4; TNRC21
Summary The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. provided by RefSeq, Oct 2010
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN421064 KMT2D - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

MLL4 Regulates the Progression of Non-Small-Cell Lung Cancer by Regulating the PI3K/AKT/SOX2 Axis
Yang, Qiu, Weng et al
Cancer Res Treat (2023)
Cited by 14
AI Summary: OriGene's CRISPRa kit (CAT＃: GA105405) was used in this study to activate gene expression, aiding the investigation of MLL4's role in non-small cell lung cancer progression.
Snippet: Purpose Mixed-lineage leukemia protein 4 (MLL4/KMT2D) is a histone methyltransferase, and its mutation has been reported to be associated with a poor prognosis in Save;CA) according to the manufacturer’s instructions. …CRISPRa kit was purchased from OriGene (CAT＃: GA105405). …
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products