OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human TCF4 activation kit by CRISPRa

Be the first to review this product
SKU
GA104778
TCF4 CRISPRa kit - CRISPR gene activation of human transcription factor 4
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA330065 Rabbit Polyclonal Anti-TCF4 Antibody
100 ul
$585.00
RC224345 TCF4 (Myc-DDK-tagged)-Human transcription factor 4 (TCF4), transcript variant 1
10 ug
$921.00

Other products for "TCF4"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol TCF4
Locus ID 6925
Components

GA104778G1, TCF4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGAGATAGCATCCTGAAA

GA104778G2, TCF4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACTCTTCCAGCTTTGCCA

GA104778G3, TCF4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGCTGCACAAGTGTTACCA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001083962, NM_001243226, NM_001243227, NM_001243228, NM_001243230, NM_001243231, NM_001243232, NM_001243233, NM_001243234, NM_001243235, NM_001243236, NM_003199, NM_001306207, NM_001306208, NM_001330604, NM_001330605, NM_001348211, NM_001348212, NM_001348213, NM_001348214, NM_001348215, NM_001348216, NM_001348217, NM_001348218, NM_001348219, NM_001348220, NM_001369567, NM_001369571, NM_001369574, NM_001369577, NM_001369579, NM_001369580, NM_001369581, NM_001369585, NM_001369586, NM_001369568, NM_001369569, NM_001369570, NM_001369572, NM_001369573, NM_001369575, NM_001369576, NM_001369578, NM_001369582, NM_001369583, NM_001369584
UniProt ID P15884
Synonyms bHLHb19; E2-2; ITF-2; ITF2; PTHS; SEF-2; SEF2; SEF2-1; SEF2-1A; SEF2-1B; SEF2-1D; TCF-4
Summary This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. provided by RefSeq, Jul 2016
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN217718 TCF4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217718BN TCF4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217718LP TCF4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN217718RB TCF4 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN417718 TCF4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products