OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human Exodus 2 (CCL21) activation kit by CRISPRa

Be the first to review this product
SKU
GA104328
CCL21 CRISPRa kit - CRISPR gene activation of human C-C motif chemokine ligand 21
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA349267 Rabbit Polyclonal Anti-CCL21 Antibody
100 ul
$205.00
RC206579 CCL21 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 21 (CCL21)
10 ug
$150.00

Other products for "CCL21"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol CCL21
Locus ID 6366
Components

GA104328G1, Exodus 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTCCAGGGGAGAGGCAGTG

GA104328G2, Exodus 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGTCTCCTCACTACGCTCC

GA104328G3, Exodus 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTAACTCTGTCACCCAGGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_002989
UniProt ID O00585
Synonyms 6Ckine; CKb9; ECL; SCYA21; SLC; TCA4
Summary This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. Similar to other chemokines the protein encoded by this gene inhibits hemopoiesis and stimulates chemotaxis. This protein is chemotactic in vitro for thymocytes and activated T cells, but not for B cells, macrophages, or neutrophils. The cytokine encoded by this gene may also play a role in mediating homing of lymphocytes to secondary lymphoid organs. It is a high affinity functional ligand for chemokine receptor 7 that is expressed on T and B lymphocytes and a known receptor for another member of the cytokine family (small inducible cytokine A19). provided by RefSeq, Sep 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN406579 CCL21 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

Mumps virus infection disrupts blood-testis barrier through the induction of TNF-α in Sertoli cells
Wu, Jiang, Gao et al
FASEB J (2019) 33 (11), 12528-12540 DOI: 10.1096/fj.201901089R
AI Summary: OriGene products contributed to this study by providing the mouse Tnfa (TNF-α) ELISA Kit (Cat# EK0527) and mouse Tlr2 (TLR2) ELISA Kit (Cat# EK0736) used to measure TNF-α and TLR2 protein levels in Sertoli cells, enabling the authors to assess the role of these proteins in mumps virus-induced blood-testis barrier disruption.
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products