OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human Polycystin 1 (PKD1) activation kit by CRISPRa

Be the first to review this product
SKU
GA103572
PKD1 CRISPRa kit - CRISPR gene activation of human polycystin 1, transient receptor potential channel interacting
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA350676 Rabbit Polyclonal Anti-PKD1 Antibody
100 ul
$205.00
RC215081 PKD1 (Myc-DDK-tagged)-Human polycystic kidney disease 1 (autosomal dominant) (PKD1), transcript variant 1
10 ug
$5,132.00

Other products for "PKD1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol PKD1
Locus ID 5310
Components

GA103572G1, Polycystin 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCGATGAGGGACTGGCATC

GA103572G2, Polycystin 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACCCTCCGCTCCACAGGGT

GA103572G3, Polycystin 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCCCGTCGCACTGTAGAGT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_000296, NM_001009944
UniProt ID P98161
Synonyms PBP; Pc-1; TRPP1
Summary This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. provided by RefSeq, Oct 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN415081 PKD1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products