OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human MEKK1 (MAP3K1) activation kit by CRISPRa

Be the first to review this product
SKU
GA102871
MAP3K1 CRISPRa kit - CRISPR gene activation of human mitogen-activated protein kinase kinase kinase 1
  $1,657.00
2 Weeks*

Frequently Bought Together (2)

TA378261 MAP3K1 Rabbit polyclonal Antibody
100 ul
$410.00
RC214358 MAP3K1 (Myc-DDK-tagged)-Human mitogen-activated protein kinase kinase kinase 1 (MAP3K1)
10 ug
$1,940.00

Other products for "MAP3K1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol MAP3K1
Locus ID 4214
Components

GA102871G1, MEKK1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCCTGGACTGACCGACGGG

GA102871G2, MEKK1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTGGCCTGGACTGACCGAC

GA102871G3, MEKK1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCTGGCCTGGACTGACCGA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_005921
UniProt ID Q13233
Synonyms MAPKKK1; MEKK; MEKK 1; MEKK1; SRXY6
Summary The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. provided by RefSeq, Mar 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN414358 MAP3K1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products