OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human CD229 (LY9) activation kit by CRISPRa

Be the first to review this product
SKU
GA102757
LY9 CRISPRa kit - CRISPR gene activation of human lymphocyte antigen 9
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA811828 LY9 mouse monoclonal antibody,clone OTI2H4 100 ul
$447.00
RC218201 LY9 (Myc-DDK-tagged)-Human lymphocyte antigen 9 (LY9), transcript variant 1
10 ug
$610.00

Other products for "LY9"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol LY9
Locus ID 4063
Components

GA102757G1, CD229 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGTGTGTGTCTCAGAGGGA

GA102757G2, CD229 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCTACCTGCCTGCGCAGAT

GA102757G3, CD229 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGCAGATGGGAGGAGTCTG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001033667, NM_001261456, NM_001261457, NM_002348
UniProt ID Q9HBG7
Synonyms CD229; hly9; mLY9; SLAMF3
Summary LY9 belongs to the SLAM family of immunomodulatory receptors (see SLAMF1; MIM 603492) and interacts with the adaptor molecule SAP (SH2D1A; MIM 300490) (Graham et al., 2006 PubMed 16365421).supplied by OMIM, Mar 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN418201 LY9 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products