OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human hemoglobin subunit gamma 1 (HBG1) activation kit by CRISPRa

Be the first to review this product
SKU
GA102075
HBG1 CRISPRa kit - CRISPR gene activation of human hemoglobin subunit gamma 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA376944 HBG1 Rabbit polyclonal Antibody
100 ul
$410.00
RC203084 HBG1 (Myc-DDK-tagged)-Human hemoglobin, gamma A (HBG1)
10 ug
$150.00

Other products for "HBG1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol HBG1
Locus ID 3047
Components

GA102075G1, hemoglobin subunit gamma 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATCTGTCTGAAACGGTCCC

GA102075G2, hemoglobin subunit gamma 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTAAACTCCACCCATGGGT

GA102075G3, hemoglobin subunit gamma 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTGGATACTCTAAGACTAT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_000559
UniProt ID P69891
Synonyms HBG-T2; HBGA; HBGR; HSGGL1; PRO2979
Summary The gamma globin genes (HBG1 and HBG2) are normally expressed in the fetal liver, spleen and bone marrow. Two gamma chains together with two alpha chains constitute fetal hemoglobin (HbF) which is normally replaced by adult hemoglobin (HbA) at birth. In some beta-thalassemias and related conditions, gamma chain production continues into adulthood. The two types of gamma chains differ at residue 136 where glycine is found in the G-gamma product (HBG2) and alanine is found in the A-gamma product (HBG1). The former is predominant at birth. The order of the genes in the beta-globin cluster is: 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN403084 HBG1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products