OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PHF10 (NM_018288) Human Untagged Clone

Be the first to review this product
SKU
SC327885
PHF10 (untagged)-Human PHD finger protein 10 (PHF10) transcript variant 1
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA346797 Rabbit Polyclonal Anti-PHF10 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PHF10 or NM_018288"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PHF10
Synonyms BAF45A; XAP135
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327885 representing NM_018288.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCGGCGGCCGGGCCCGGGGCTGCGCTGTCCCCGCGGCCGTGCGACAGCGACCCAGCCACCCCC
GGAGCGCAGTCCCCGAAGGATGATAATGAAGATAATTCAAATGATGGGACCCAGCCATCCAAAAGGAGG
CGAATGGGCTCAGGAGATAGTTCTAGGAGTTGTGAAACTTCAAGTCAAGATCTTGGTTTTAGTTACTAT
CCAGCAGAAAACTTGATAGAGTACAAATGGCCACCTGATGAAACAGGAGAATACTATATGCTTCAAGAA
CAAGTCAGTGAATATTTGGGTGTGACCTCCTTTAAAAGGAAATATCCAGATTTAGAGCGACGAGATTTG
TCTCACAAGGAGAAACTCTACCTGAGAGAGCTAAATGTCATTACTGAAACTCAGTGCACTCTAGGCTTA
ACAGCATTGCGCAGTGATGAAGTGATTGATTTAATGATAAAAGAATATCCAGCCAAACATGCTGAGTAT
TCTGTTATTCTACAAGAAAAAGAACGTCAACGAATTACAGACCATTATAAAGAGTATTCCCAAATGCAA
CAACAGAATACTCAGAAAGTTGAAGCCAGTAAAGTGCCTGAGTATATTAAGAAAGCTGCCAAAAAAGCA
GCAGAATTTAATAGCAACTTAAACCGGGAACGCATGGAAGAAAGAAGAGCTTATTTTGACTTGCAGACA
CATGTTATCCAGGTACCTCAAGGGAAGTACAAAGTTTTGCCAACAGAGCGAACAAAGGTCAGTTCTTAC
CCAGTGGCTCTCATCCCCGGACAGTTCCAGGAATATTATAAGAGGTACTCACCAGATGAGCTGCGGTAT
CTGCCATTAAACACAGCCCTGTATGAGCCCCCTCTGGATCCTGAGCTCCCTGCTCTAGACAGTGATGGT
GATTCAGATGATGGCGAAGATGGTCGAGGTGATGAGAAACGGAAAAATAAAGGCACTTCGGACAGCTCC
TCTGGCAATGTATCTGAAGGGGAAAGCCCTCCTGACAGCCAGGAGGACTCTTTCCAGGGAAGACAGAAA
TCAAAAGACAAAGCTGCCACTCCAAGAAAAGATGGTCCCAAACGTTCTGTACTGTCCAAGTCAGTTCCT
GGGTACAAGCCAAAGGTCATTCCAAATGCTATATGTGGAATTTGTCTGAAGGGTAAGGAGTCCAACAAG
AAAGGAAAGGCTGAATCACTTATACACTGCTCCCAATGTGAGAATAGTGGCCATCCTTCTTGCCTGGAT
ATGACAATGGAGCTTGTTTCTATGATTAAGACCTACCCATGGCAGTGTATGGAATGTAAAACATGCATT
ATATGTGGACAACCCCACCATGAAGAAGAAATGATGTTCTGTGATATGTGTGACAGAGGTTATCATACT
TTTTGTGTGGGCCTTGGTGCTATTCCATCAGGTCGCTGGATTTGTGACTGTTGTCAGCGGGCCCCCCCA
ACACCCAGGAAAGTGGGCAGAAGGGGGAAAAACAGCAAAGAGGGATAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_018288
Insert Size 1497 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018288.3
RefSeq Size 1692 bp
RefSeq ORF 1497 bp
Locus ID 55274
UniProt ID Q8WUB8
Cytogenetics 6q27
Domains PHD
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
MW 56.1 kDa
Summary This gene contains a predicted ORF that encodes a protein with two zinc finger domains. The function of the encoded protein is not known. Sequence analysis suggests that multiple alternatively spliced transcript variants are derived from this gene but the full-length nature of only two of them is known. These two splice variants encode different isoforms. A pseudogene for this gene is located on Xq28. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) encodes the longer isoform.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_018288" in other vectors (7)
SKU Description Size Price
RC210609 PHF10 (Myc-DDK-tagged)-Human PHD finger protein 10 (PHF10), transcript variant 1 10 ug
$457.00
RC210609L1 Lenti ORF clone of Human PHD finger protein 10 (PHF10), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC210609L2 Lenti ORF clone of Human PHD finger protein 10 (PHF10), transcript variant 1, mGFP tagged 10 ug
$757.00
RC210609L3 Lenti ORF clone of Human PHD finger protein 10 (PHF10), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC210609L4 Lenti ORF clone of Human PHD finger protein 10 (PHF10), transcript variant 1, mGFP tagged 10 ug
$757.00
RG210609 PHF10 (tGFP-tagged) - Human PHD finger protein 10 (PHF10), transcript variant 1 10 ug
$489.00 $657.00
SC111822 PHF10 (untagged)-Human PHD finger protein 10 (PHF10), transcript variant 1 10 ug
$457.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products