OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PCBP3 (NM_020528) Human Untagged Clone

Be the first to review this product
SKU
SC327811
PCBP3 (untagged)-Human poly(rC) binding protein 3 (PCBP3) transcript variant 1
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA343897 Rabbit Polyclonal Anti-PCBP3 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PCBP3 or NM_020528"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PCBP3
Synonyms ALPHA-CP3; PCBP3-OT1; PCBP3OT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327811 representing NM_020528.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGGAAGGTGACGCCTTCTGGGCCCCATCTGTCCTTCCTCACAGCACCCTCAGCACCTTAAGCCAC
CACCCTCAGCCACAATTTGGCAGAAGGATGGAGTCCAAGGTCTCAGAAGGTGGCCTGAATGTGACCCTC
ACCATCCGCCTGCTGATGCATGGAAAGGAAGTTGGAAGCATCATCGGGAAGAAAGGAGAAACTGTGAAG
AAGATGCGTGAGGAGAGTGGTGCAAGGATCAACATCTCAGAGGGAAACTGCCCAGAGAGGATTGTGACC
ATCACAGGCCCCACAGACGCCATCTTCAAGGCCTTTGCCATGATCGCATACAAGTTTGAGGAGGATATC
ATCAACTCCATGAGCAACAGCCCTGCCACCAGCAAGCCCCCAGTGACGCTGAGGCTGGTGGTGCCTGCC
AGCCAGTGTGGGTCCCTGATCGGCAAAGGAGGCTCCAAGATCAAGGAGATCAGGGAGTCCACAGGTGCC
CAGGTGCAGGTGGCTGGGGACATGCTGCCCAACTCCACGGAGCGAGCGGTGACCATCTCGGGGACCCCA
GATGCCATCATCCAGTGCGTCAAGCAGATCTGTGTGGTCATGCTGGAGTCCCCACCGAAAGGTGCCACC
ATTCCCTACCGCCCAAAGCCCGCCTCCACCCCTGTCATTTTTGCAGGTGGTCAGGCCTACACAATCCAG
GGACAGTATGCCATCCCTCACCCGGATCAGTTGACCAAGCTCCACCAGTTGGCCATGCAGCAAACCCCC
TTTCCTCCCCTCGGACAGACCAACCCCGCTTTCCCCGGAGAAAAGCTGCCTTTACACTCCTCCGAAGAA
GCTCAAAATCTGATGGGCCAGTCATCAGGTCTGGACGCCAGCCCACCGGCCAGCACTCATGAGCTCACC
ATTCCCAATGATCTAATAGGCTGCATAATTGGACGCCAAGGGACCAAAATCAATGAAATTCGACAGATG
TCTGGAGCTCAGATCAAAATCGCCAACGCCACGGAAGGGTCCTCAGAGCGTCAGATCACCATCACGGGG
ACCCCGGCCAACATCAGCCTTGCCCAGTATCTCATCAACGCCAGGCTGACGTCCGAGGTCACCGGGATG
GGCACGCTGTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_020528
Insert Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020528.2
RefSeq Size 2000 bp
RefSeq ORF 1116 bp
Locus ID 54039
UniProt ID P57721
Cytogenetics 21q22.3
Domains KH
MW 39.5 kDa
Summary This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. The protein encoded by this gene lacks the nuclear localization signals found in other subfamily members. Alternative splicing results in multiple transcript variants encoding distinct isoforms. provided by RefSeq, Jan 2017
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_020528" in other vectors (5)
SKU Description Size Price
RC229176 PCBP3 (Myc-DDK-tagged)-Human poly(rC) binding protein 3 (PCBP3), transcript variant 1 10 ug
$457.00
RC229176L3 Lenti ORF clone of Human poly(rC) binding protein 3 (PCBP3), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC229176L4 Lenti ORF clone of Human poly(rC) binding protein 3 (PCBP3), transcript variant 1, mGFP tagged 10 ug
$757.00
RG229176 PCBP3 (tGFP-tagged) - Human poly(rC) binding protein 3 (PCBP3), transcript variant 1 10 ug
$657.00
SC113092 PCBP3 (untagged)-Human poly(rC) binding protein 3 (PCBP3), transcript variant 1 10 ug
$457.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products