OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SYNC (NM_001161708) Human Untagged Clone

Be the first to review this product
SKU
SC327029
SYNC (untagged)-Human syncoilin intermediate filament protein (SYNC) transcript variant 2
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA809588 SYNC mouse monoclonal antibody,clone OTI5B8 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SYNC or NM_001161708"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SYNC
Synonyms SYNC1; SYNCOILIN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC327029 representing NM_001161708.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCAGCCCGGAGCCCCGGCGCGGCGGGGACGGCGCCGCCCAGGCCGCGAGGAAAACAAGAGTAGAG
GCCAATTCTCCTCTTCCAAAGAACTCTGGATCCCTAAATGAGGCAGAAGCCTTGAACCCAGAAGTTACT
CTATCTTCAGAGGGGTCCTTAAACCTCGAAGACATTCTCTACCTGGAGGACACAGGTGACCTTGATGAG
ACACTCTATGTGCAAGAGACTGAGAAGGCAGAGGAGGCCCTGTATATTGAGGAGGCCATGCAGCCAGAT
GAGGCTCTGCATGTGGAGGAGCCTGGGAATCCAGAGGAGACAGTGTGTGTGGAGGAAACCACGGAGCCA
GATCGGATACAGTTTGTGGAGGGGCCCGTGGAGCCAGGAAAGCCCACAAGCCCAGAGCACGTTGTTTAT
GAGGGAGAGACAGTCACAAGGGCGGAGAAATCTAACCCTGAGGAGAGCCTCAGAGCCGAGCAGAGCCCC
AGCGTGGAGGAGAACCTGAGCATAGAGGACCTGGAATTGCTAGAGGGGCGTTTCCAGCAGTGTGTCCAA
GCTGTGGCCCAGCTGGAAGAGGAGAGGGATCAGCTCATCCATGAGCTTGTATTGCTCCGGGAACCAGCC
CTGCAGGAGGTACAGCAAGTCCATCAAGACATCCTGGCTGCCTACAAGCTCCATGCCCAAGCAGAGCTG
GAGAGAGATGGCCTAAGGGAGGAGATCCGGCTGGTCAAGCAGAAGCTTTTCAAAGTGACAAAGGAATGT
GTGGCCTACCAATACCAGCTGGAGTGCCGCCAGCAGGACGTGGCTCAGTTTGCCGATTTCCGGGAAGTG
CTGACTACAAGGGCAACCCAGCTCTCAGAGGAACTGGCCCAGCTCCGGGATGCCTATCAGAAGCAGAAG
GAGCAGCTGCGGCAACAACTAGAAGCCCCTCCAAGCCAGAGGGATGGGCACTTTCTCCAGGAAAGCCGG
CGACTCTCTGCCCAGTTTGAAAATCTCATGGCAGAGAGCCGCCAGGACCTGGAGGAGGAGTATGAGCCT
CAGTTCCTGCGGCTCCTAGAGAGGAAAGAAGCTGGGACCAAAGCTCTGCAGAGAACCCAGGCTGAGATC
CAGGAAATGAAGGAGGCTCTGAGACCCCTGCAAGCAGAGGCCCGGCAGCTCCGCCTGCAAAACAGGAAC
CTGGAGGACCAGATCGCACTTGTGAGGCAAAAACGAGATGAAGAGGTGCAGCAGTACAGGGAACAGCTG
GAGGAAATGGAAGAACGCCAGAGGCAGTTAAGAAATGGGGTGCAACTCCAGCAACAGAAGAACAAAGAG
ATGGAACAGCTAAGGCTCAGTCTTGCTGAAGAGCTCTCTACTTATAAGGGCTGTTTAGAAATATATGGC
CAAATCTGTAACCCGGAAACAGCAAAAAACTTCTTAGCAAAGGATCACTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001161708
Insert Size 1431 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001161708.1
RefSeq Size 3413 bp
RefSeq ORF 1431 bp
Locus ID 81493
UniProt ID Q9H7C4
Cytogenetics 1p35.1
MW 54.9 kDa
Summary This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jun 2009
Transcript Variant: This variant (2) lacks an alternate exon, compared to variant 1, that causes a frameshift. The resulting protein (isoform 2) has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001161708" in other vectors (4)
SKU Description Size Price
RC228394 SYNC (Myc-DDK-tagged)-Human syncoilin, intermediate filament protein (SYNC), transcript variant 2 10 ug
$457.00
RC228394L3 Lenti ORF clone of Human syncoilin, intermediate filament protein (SYNC), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC228394L4 Lenti ORF clone of Human syncoilin, intermediate filament protein (SYNC), transcript variant 2, mGFP tagged 10 ug
$757.00
RG228394 SYNC (tGFP-tagged) - Human syncoilin, intermediate filament protein (SYNC), transcript variant 2 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products