OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PNPLA4 (NM_004650) Human Untagged Clone

Be the first to review this product
SKU
SC324530
PNPLA4 (untagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA346729 Rabbit Polyclonal Anti-PNPLA4 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PNPLA4 or NM_004650"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PNPLA4
Synonyms DXS1283E; GS2; iPLA2eta
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004650.1 GGCCGGGTGCGGTACCAACCCCTGCCGCAGGACTTTCCTGGGCCGGCTCGCGGAGAGCGT
AGCGCGGCCTTGGTGGCGGAATGGCGTTGAGTGACGGCCCGGCCCCGCCATCTGGTTAAA
GGGACTCGTTCAACACGGAAGTGTCCCGGGGCTGCATTGTGCTACAGCTAGAATGAAGCA
CATCAACCTATCATTTGCAGCGTGTGGATTTCTGGGCATTTACCACTTGGGGGCAGCATC
TGCACTTTGCAGACATGGCAAAAAACTTGTGAAGGATGTCAAAGCCTTCGCTGGGGCGTC
TGCGGGATCGTTGGGTGCTTCTGTTCTGCTAACAGCACCAGAAAAAATAGAGGAATGTAA
CCAATTTACCTACAAGTTTGCCGAAGAAATCAGAAGGCAGTCTTTCGGGGCAGTAACGCC
CGGTTATGACTTCATGGCCCGACTAAGAAGTGGGATGGAGTCGATTCTTCCTCCCAGCGC
TCACGAGCTGGCCCAGAACCGACTGCACGTATCCATCACCAACGCCAAAACCAGAGAAAA
TCACTTAGTCTCCACTTTTTCCTCCAGGGAGGGCCTCATTAAGGTCCTCCTAGCCAGCAG
TTTTGTGCCCATTTATGCAGGACTGAAGCTAGTGGAATACAAAGGGCAGAAGTGGGTGGA
CGGAGGCCTCACCAACGCTCTTCCCATCCTGCCCGTCGGCCGGACAGTAACCATCTCCCC
CTTCAGTGGACGACTGGACATCTCCCCGCAGGACAAAGGGCAGCTAGATCTGTATGTTAA
TATCGCCAAGCAGGATATCATGTTGTCCCTGGCAAACCTGGTGAGACTCAACCAAGCCCT
TTTTCCCCCAAGCAAGAGGAAAATGGAATCTTTGTATCAGTGTGGTTTTGATGACACTGT
TAAGTTTTTACTTAAAGAAAATTGGTTTGAATAAAATGCATAAAAGTTTATAATGCAGAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_004650
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004650.1, NP_004641.1
RefSeq Size 2809 bp
RefSeq ORF 762 bp
Locus ID 8228
UniProt ID P41247
Cytogenetics Xp22.31
Protein Pathways Retinol metabolism
Summary This gene encodes a member of the patatin-like family of phospholipases. The encoded enzyme has both triacylglycerol lipase and transacylase activities and may be involved in adipocyte triglyceride homeostasis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome Y. provided by RefSeq, Feb 2010
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1 and 2 encode the same isoform (1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_004650" in other vectors (5)
SKU Description Size Price
RC204732 PNPLA4 (Myc-DDK-tagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1 10 ug
$300.00
RC204732L3 Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC204732L4 Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1, mGFP tagged 10 ug
$600.00
RG204732 PNPLA4 (tGFP-tagged) - Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1 10 ug
$489.00 $500.00
SC121700 PNPLA4 (untagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 1 10 ug
$300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products