OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SOD2 (NM_000636) Human Untagged Clone

Be the first to review this product
SKU
SC323760
SOD2 (untagged)-Human superoxide dismutase 2, mitochondrial (SOD2), nuclear gene encoding mitochondrial protein, transcript variant 1
  $450.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA591033 Rabbit monoclonal anti-SODM antibody for SISCAPA, clone OTIR4G8
100 ul
$519.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SOD2 or NM_000636"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SOD2
Synonyms GClnc1; IPO-B; IPOB; Mn-SOD; MNSOD; MVCD6
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000636.2 CTTCGGCAGCGGCTTCAGCAGATCGGCGGCATCAGCGGTAGCACCAGCACTAGCAGCATG
TTGAGCCGGGCAGTGTGCGGCACCAGCAGGCAGCTGGCTCCGGTTTTGGGGTATCTGGGC
TCCAGGCAGAAGCACAGCCTCCCCGACCTGCCCTACGACTACGGCGCCCTGGAACCTCAC
ATCAACGCGCAGATCATGCAGCTGCACCACAGCAAGCACCACGCGGCCTACGTGAACAAC
CTGAACGTCACCGAGGAGAAGTACCAGGAGGCGTTGGCCAAGGGAGATGTTACAGCCCAG
ATAGCTCTTCAGCCTGCACTGAAGTTCAATGGTGGTGGTCATATCAATCATAGCATTTTC
TGGACAAACCTCAGCCCTAACGGTGGTGGAGAACCCAAAGGGGAGTTGCTGGAAGCCATC
AAACGTGACTTTGGTTCCTTTGACAAGTTTAAGGAGAAGCTGACGGCTGCATCTGTTGGT
GTCCAAGGCTCAGGTTGGGGTTGGCTTGGTTTCAATAAGGAACGGGGACACTTACAAATT
GCTGCTTGTCCAAATCAGGATCCACTGCAAGGAACAACAGGCCTTATTCCACTGCTGGGG
ATTGATGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAATGTCAGGCCTGATTATCTA
AAAGCTATTTGGAATGTAATCAACTGGGAGAATGTAACTGAAAGATACATGGCTTGCAAA
AAGTAAACCACGATCGTTATGCTGATCATACCCTAATGATCCCAGCAAGATAACGTCCTG
TCTTCTAAGATGTGCATCAAGCCTGGTACATACTGAAAACCCTATAAGGTCCTGGATAAT
TTTTGTTTGATTATTCATTGAAGAAACATTTATTTTCCAATTGTGTGAAGTTTTTGACTG
TTAATAAAAGAATCTGTCAACCATCAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT |
ACCN NM_000636
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000636.2, NP_000627.2
RefSeq Size 1593 bp
RefSeq ORF 669 bp
Locus ID 6648
UniProt ID P04179
Cytogenetics 6q25.3
Domains sodfe
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Huntington's disease
Summary This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. provided by RefSeq, Apr 2016
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (A). Both variants 1 and 2 encode the same isoform (A). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_000636" in other vectors (7)
SKU Description Size Price
RC202330 SOD2 (Myc-DDK-tagged)-Human superoxide dismutase 2, mitochondrial (SOD2), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$450.00
RC202330L1 Lenti ORF clone of Human superoxide dismutase 2, mitochondrial (SOD2), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC202330L2 Lenti ORF clone of Human superoxide dismutase 2, mitochondrial (SOD2), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$750.00
RC202330L3 Lenti ORF clone of Human superoxide dismutase 2, mitochondrial (SOD2), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC202330L4 Lenti ORF clone of Human superoxide dismutase 2, mitochondrial (SOD2), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$750.00
RG202330 SOD2 (tGFP-tagged) - Human superoxide dismutase 2, mitochondrial (SOD2), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$650.00
SC127816 SOD2 (untagged)-Human superoxide dismutase 2, mitochondrial (SOD2), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$450.00

file-alt Citations

Theaflavin-3,3′-digallate, a black tea polyphenol, stimulates lipolysis associated with the induction of mitochondrial uncoupling proteins and AMPK–FoxO3A–MnSOD pathway in 3T3-L1 adipocytes
Ko, Lo, Wang et al
Journal of Functional Foods (2015) 17, 271–282
AI Summary: OriGene contributed to this study by providing the pCMV-AC-MnSOD gene construct (human MnSOD cDNA in pCMV-AC vector), which was used to overexpress MnSOD in 3T3-L1 adipocytes.
Snippet: ray film. 2.7. MnSOD overexpression. Gene construct with insertion of human MnSOD cDNA in pCMV-AC vector (pCMV-AC-MnSOD) validated for expression was obtained from OriGene Technology (Rockville, MD, USA). 3T3 ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products